Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11098
Trapped Gene
Plaur (ENSMUSG00000046223)
Vector Insertion
Chr 7: 25251838 - 25256917
Public Clones G054F08 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 32% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000199610 (Chr7:25251694..25251837 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGTGGTGACAAGAGGCTGT Chr7:25251709..25251728 59.76 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000199610 (Chr7:25251694..25251837 +)
Downstram Exon
ENSMUSE00000199617 (Chr7:25256918..25257073 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGTGGTGACAAGAGGCTGT Chr7:25251709..25251728 59.76 55 GGACGCACACTCGAGGTAAC Chr7:25256970..25256989 60.72 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000199609 Chr7:25247519..25247586 No primer for this exon
upstream ENSMUSE00000199614 Chr7:25250150..25250260 GCCTGGTAGAGGAGTGTGCT Chr7:25250195..25250214 59.48 60
upstream ENSMUSE00000199610 Chr7:25251694..25251837 AGGTGGTGACAAGAGGCTGT Chr7:25251709..25251728 59.76 55

*** Putative Vector Insertion (Chr 7: 25251838 - 25256917) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000199617 Chr7:25256918..25257073 GGACGCACACTCGAGGTAAC Chr7:25256970..25256989 60.72 60
downstream ENSMUSE00000199612 Chr7:25257592..25257726 CACCATTGCAGTGGGTGTAG Chr7:25257723..25257742 60.03 55
downstream ENSMUSE00000320820 Chr7:25259229..25259375 GTAGCCACCAGGCACTGATT Chr7:25259367..25259386 60.14 55
downstream ENSMUSE00000452329 Chr7:25260258..25260903 CAATGAGGCTGAGTTGAGCA Chr7:25260443..25260462 60.14 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTAGAGTCTTGGGAGTCCTAGTT Chr7:25251789..25251813 58.44 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTAGAGTCTTGGGAGTCCTAGTT Chr7:25251789..25251813 58.44 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000046223