Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11118
Trapped Gene
Cox4i1 (ENSMUSG00000031818)
Vector Insertion
Chr 8: 123197253 - 123197870
Public Clones G047A06 (ggtc) G038D11 (ggtc) CMHD-GT_419F12-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 74% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000213319 (Chr8:123197121..123197252 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACCGCATCCAGTTTAACGAG Chr8:123197124..123197143 60.13 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000213319 (Chr8:123197121..123197252 +)
Downstram Exon
ENSMUSE00000213321 (Chr8:123197871..123198107 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACCGCATCCAGTTTAACGAG Chr8:123197124..123197143 60.13 50 CCCAGTCACGATCGAAAGTA Chr8:123197912..123197931 58.72 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000302979 Chr8:123192190..123192255 GAGCACCCCAGGGTGTAGAG Chr8:123192201..123192220 62.03 65
upstream ENSMUSE00000213317 Chr8:123193209..123193282 GAGCCTGATTGGCAAGAGAG Chr8:123193230..123193249 60.1 55
upstream ENSMUSE00000213318 Chr8:123196625..123196792 ACTACCCCTTGCCTGATGTG Chr8:123196679..123196698 59.99 55
upstream ENSMUSE00000213319 Chr8:123197121..123197252 ACCGCATCCAGTTTAACGAG Chr8:123197124..123197143 60.13 50

*** Putative Vector Insertion (Chr 8: 123197253 - 123197870) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000213321 Chr8:123197871..123198107 CCCAGTCACGATCGAAAGTA Chr8:123197912..123197931 58.72 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTTCTTCATTGGCTTCACTGC Chr8:123197204..123197225 59.87 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCTCTTGGTGCTCGTGACT Chr8:123197291..123197311 60.21 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031818