Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11119
Trapped Gene
Trap1 (ENSMUSG00000005981)
Vector Insertion
Chr 16: 4040432 - 4043952
Public Clones G046H09 (ggtc)
Private Clones OST379707 (lexicon)
Severity of mutation (?) Insertion after 92% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000295289 (Chr16:4043953..4044098 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000295289 (Chr16:4043953..4044098 -)
Downstram Exon
ENSMUSE00000295279 (Chr16:4040359..4040431 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000295399 Chr16:4077693..4077796 No primer for this exon
upstream ENSMUSE00000295391 Chr16:4068857..4069021 No primer for this exon
upstream ENSMUSE00000295385 Chr16:4068256..4068338 No primer for this exon
upstream ENSMUSE00000127861 Chr16:4065233..4065373 No primer for this exon
upstream ENSMUSE00000127865 Chr16:4062330..4062401 No primer for this exon
upstream ENSMUSE00000127855 Chr16:4060757..4060917 No primer for this exon
upstream ENSMUSE00000127874 Chr16:4056330..4056439 No primer for this exon
upstream ENSMUSE00000127854 Chr16:4055797..4055870 No primer for this exon
upstream ENSMUSE00000127868 Chr16:4054754..4054909 No primer for this exon
upstream ENSMUSE00000127856 Chr16:4053481..4053601 No primer for this exon
upstream ENSMUSE00000127862 Chr16:4052865..4052934 No primer for this exon
upstream ENSMUSE00000127873 Chr16:4049351..4049498 No primer for this exon
upstream ENSMUSE00000127872 Chr16:4045880..4046065 No primer for this exon
upstream ENSMUSE00000127864 Chr16:4045443..4045581 No primer for this exon
upstream ENSMUSE00000127866 Chr16:4044613..4044698 No primer for this exon
upstream ENSMUSE00000295289 Chr16:4043953..4044098 No primer for this exon

*** Putative Vector Insertion (Chr 16: 4040432 - 4043952) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000295279 Chr16:4040359..4040431 No primer for this exon
downstream ENSMUSE00000295269 Chr16:4039981..4040224 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGGAGATCAACCCCAGGTA Chr16:4043948..4043968 59.92 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGAGATCAACCCCAGGTAG Chr16:4040947..4040967 59.92 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000005981