Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1113
Trapped Gene
2410017P07Rik (ENSMUSG00000019813)
Vector Insertion
Chr 10: 41465738 - 41529378
Public Clones (sanger) (sanger) (sanger) CC0752 (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) D158D07 (ggtc) (ggtc) E028E05 (ggtc) 5SE284H05 (ggtc)
(ggtc) M124C10 (ggtc) D158D07 (ggtc) (ggtc) (ggtc) M115A03 (ggtc)
IST10899D5 (tigm) IST12312C11 (tigm) IST10871F2 (tigm) IST14440E1 (tigm)
IST12061H4 (tigm) IST14432E7 (tigm) IST14946E7 (tigm) IST14268F5 (tigm)
IST14409B8 (tigm) IST12525D6 (tigm) IST14924E7 (tigm) IST10729G4HMF1 (tigm)
IST12828E8 (tigm) IST10072G10 (tigm) IST12061H4 (tigm) IST14572F9 (tigm)
IST14318C7 (tigm) IST10894G7 (tigm) IST13547G11 (tigm) IST11616D4 (tigm)
IST10917A4 (tigm) IST14954C3 (tigm) IST11745D12 (tigm) IST14842A12 (tigm)
Private Clones OST452219 (lexicon) OST434937 (lexicon) OST434374 (lexicon) OST423223 (lexicon)
OST409133 (lexicon) OST406919 (lexicon) OST406797 (lexicon) OST383578 (lexicon)
OST377953 (lexicon) OST347290 (lexicon) OST317937 (lexicon) OST314694 (lexicon)
OST310267 (lexicon) OST307326 (lexicon) OST300572 (lexicon) OST285451 (lexicon)
OST284294 (lexicon) OST271924 (lexicon) OST263495 (lexicon) OST262597 (lexicon)
OST261678 (lexicon) OST252088 (lexicon) OST251404 (lexicon) OST250240 (lexicon)
OST250160 (lexicon) OST240830 (lexicon) OST238024 (lexicon) OST235142 (lexicon)
OST232871 (lexicon) OST226157 (lexicon) OST221794 (lexicon) OST217311 (lexicon)
OST213551 (lexicon) OST209710 (lexicon) OST203988 (lexicon) OST199964 (lexicon)
OST198612 (lexicon) OST195485 (lexicon) OST195441 (lexicon) OST193898 (lexicon)
OST185992 (lexicon) OST179371 (lexicon) OST156136 (lexicon) OST155193 (lexicon)
OST149855 (lexicon) OST130713 (lexicon) OST127463 (lexicon) OST126147 (lexicon)
OST119455 (lexicon) OST99220 (lexicon) OST56337 (lexicon) OST54159 (lexicon)
OST54093 (lexicon) OST43261 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000389068 (Chr10:41529379..41529469 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000389068 (Chr10:41529379..41529469 -)
Downstram Exon
ENSMUSE00000666439 (Chr10:41465577..41465737 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000355238 Chr10:41529594..41529681 No primer for this exon
upstream ENSMUSE00000389068 Chr10:41529379..41529469 No primer for this exon

*** Putative Vector Insertion (Chr 10: 41465738 - 41529378) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000428456 Chr10:41465577..41465727 No primer for this exon
downstream ENSMUSE00000666439 Chr10:41465577..41465737 No primer for this exon
downstream ENSMUSE00000098241 Chr10:41462848..41463027 No primer for this exon
downstream ENSMUSE00000098231 Chr10:41460646..41460767 No primer for this exon
downstream ENSMUSE00000666437 Chr10:41460646..41460719 No primer for this exon
downstream ENSMUSE00000098230 Chr10:41450805..41450921 No primer for this exon
downstream ENSMUSE00000098249 Chr10:41449137..41449214 No primer for this exon
downstream ENSMUSE00000535871 Chr10:41448434..41448520 No primer for this exon
downstream ENSMUSE00000098244 Chr10:41443667..41443744 No primer for this exon
downstream ENSMUSE00000098250 Chr10:41442690..41442811 No primer for this exon
downstream ENSMUSE00000296788 Chr10:41441363..41441507 No primer for this exon
downstream ENSMUSE00000387291 Chr10:41438652..41439713 No primer for this exon
downstream ENSMUSE00000666438 Chr10:41438649..41439713 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGATGCACCTAATCGCCTTG Chr10:41478316..41478336 60.24 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCTCGTGACTGGGAAAACC Chr10:41478311..41478331 60.09 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AGGCCTGGCTGTAATGCAAA Chr10:41478494..41478514 62.94 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AGGCCTGGCTGTAATGCAAA Chr10:41478494..41478514 62.94 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000019813