Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11147
Trapped Gene
Dcbld1 (ENSMUSG00000019891)
Vector Insertion
Chr 10: 51981746 - 52003908
Public Clones (sanger) (sanger) (sanger) G031G07 (ggtc) E325G07 (ggtc) M093E01 (ggtc)
G054H03 (ggtc) G034C06 (ggtc) G071G01 (ggtc) G004A07 (ggtc) G063A04 (ggtc)
G073F01 (ggtc) G004C02 (ggtc) CMHD-GT_374E12-3 (cmhd) IST15025B7 (tigm)
IST10916G2 (tigm) IST10920H1 (tigm) IST11925H4 (tigm) IST10403A5 (tigm)
IST11549F2 (tigm) IST10920H1 (tigm) IST11801H3 (tigm)
Private Clones OST446174 (lexicon) OST442331 (lexicon) OST360811 (lexicon) OST300356 (lexicon)
OST33585 (lexicon)
Severity of mutation (?) Insertion after 7% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000466026 (Chr10:51981533..51981745 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000466026 (Chr10:51981533..51981745 +)
Downstram Exon
ENSMUSE00000302877 (Chr10:52003909..52004043 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000502943 Chr10:51953425..51953641 No primer for this exon
upstream ENSMUSE00000466026 Chr10:51981533..51981745 No primer for this exon

*** Putative Vector Insertion (Chr 10: 51981746 - 52003908) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000302877 Chr10:52003909..52004043 No primer for this exon
downstream ENSMUSE00000302871 Chr10:52006154..52006205 No primer for this exon
downstream ENSMUSE00000302865 Chr10:52010657..52010729 No primer for this exon
downstream ENSMUSE00000490106 Chr10:52024393..52024526 No primer for this exon
downstream ENSMUSE00000487939 Chr10:52031206..52031246 No primer for this exon
downstream ENSMUSE00000098830 Chr10:52032620..52032707 No primer for this exon
downstream ENSMUSE00000098836 Chr10:52034161..52034210 No primer for this exon
downstream ENSMUSE00000098834 Chr10:52036838..52036957 No primer for this exon
downstream ENSMUSE00000447452 Chr10:52039282..52040081 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTGGGGGATCTGTAAGCAT Chr10:51984759..51984779 60.34 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCATATCGTGACTGGGAAAA Chr10:51984791..51984811 58.57 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000019891