Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11152
Trapped Gene
Ltbp4 (ENSMUSG00000040488)
Vector Insertion
Chr 7: 28111843 - 28112279
Public Clones G056F12 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 45% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000362610 (Chr7:28112280..28112531 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTCTGCCTACTCGTCGACCT Chr7:28112509..28112528 60.01 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000362610 (Chr7:28112280..28112531 -)
Downstram Exon
ENSMUSE00000307165 (Chr7:28111711..28111842 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTCTGCCTACTCGTCGACCT Chr7:28112509..28112528 60.01 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000501397 Chr7:28122447..28122711 AGAAAGTGAGTCGGCCTCTG Chr7:28122681..28122700 59.6 55
upstream ENSMUSE00000676489 Chr7:28120696..28120730 TGTCACTGCTGCCTAGACCA Chr7:28120701..28120720 60.62 55
upstream ENSMUSE00000488113 Chr7:28120672..28120730 GCTGCCTAGACCAGACACCT Chr7:28120694..28120713 59.48 60
upstream ENSMUSE00000490043 Chr7:28120416..28120554 CAGTCCCGTGGAGAAGAGTC Chr7:28120444..28120463 59.83 60
upstream ENSMUSE00000484703 Chr7:28119856..28119965 GAAAAGAAGGCCCCCACATC Chr7:28119880..28119899 62.97 55
upstream ENSMUSE00000676487 Chr7:28118431..28118648 CTCTGGGTGTCGCTATTGGT Chr7:28118583..28118602 60.13 55
upstream ENSMUSE00000676486 Chr7:28118374..28118428 No primer for this exon
upstream ENSMUSE00000708828 Chr7:28118374..28118667 CTCTGGGTGTCGCTATTGGT Chr7:28118583..28118602 60.13 55
upstream ENSMUSE00000709573 Chr7:28118374..28118632 CTCTGGGTGTCGCTATTGGT Chr7:28118583..28118602 60.13 55
upstream ENSMUSE00000716944 Chr7:28118374..28118682 CTCTGGGTGTCGCTATTGGT Chr7:28118583..28118602 60.13 55
upstream ENSMUSE00000307052 Chr7:28115146..28115337 TCCCTTGATCTGTCACAACG Chr7:28115311..28115330 59.68 50
upstream ENSMUSE00000535658 Chr7:28114590..28114837 TTTAGAGAACTGCGCGGAAG Chr7:28114594..28114613 60.65 50
upstream ENSMUSE00000535657 Chr7:28114398..28114500 CCTGGGGTGTTCATGATTGT Chr7:28114420..28114439 60.63 50
upstream ENSMUSE00000535656 Chr7:28113987..28114061 ACCCGGCTTCGAGAGAGTTA Chr7:28114002..28114021 61.28 55
upstream ENSMUSE00000535654 Chr7:28113759..28113881 GTGTATGTCCGGACGGTTTC Chr7:28113790..28113809 60.24 55
upstream ENSMUSE00000535653 Chr7:28113205..28113369 GCCAGCTCTGTCCACCTTAT Chr7:28113212..28113231 59.31 55
upstream ENSMUSE00000407351 Chr7:28112657..28112806 TGACCTCCGATACAACACCA Chr7:28112735..28112754 59.96 50
upstream ENSMUSE00000362610 Chr7:28112280..28112531 TTCTGCCTACTCGTCGACCT Chr7:28112509..28112528 60.01 55

*** Putative Vector Insertion (Chr 7: 28111843 - 28112279) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000307165 Chr7:28111711..28111842 No primer for this exon
downstream ENSMUSE00000307108 Chr7:28111506..28111631 GCCTGGTGTATTCTCGCAAC Chr7:28111545..28111564 60.67 55
downstream ENSMUSE00000307161 Chr7:28110697..28110822 CGGGACACACACATAGGAAA Chr7:28110714..28110733 59.42 50
downstream ENSMUSE00000307156 Chr7:28110038..28110280 No primer for this exon
downstream ENSMUSE00000307950 Chr7:28109313..28109438 GTTGGGCAGACACACTTGAA Chr7:28109329..28109348 59.73 50
downstream ENSMUSE00000308043 Chr7:28109106..28109225 AGCGGTTCTCACACTCATCC Chr7:28109180..28109199 60.27 55
downstream ENSMUSE00000308034 Chr7:28108161..28108289 No primer for this exon
downstream ENSMUSE00000308025 Chr7:28107830..28107955 GACAAGATGCTCCACGAGGT Chr7:28107811..28107830 60.27 55
downstream ENSMUSE00000308018 Chr7:28107308..28107430 AGATCCTCTTCGCTGCACTC Chr7:28107381..28107400 59.71 55
downstream ENSMUSE00000308012 Chr7:28107041..28107172 TGGTAACCTGGATCGCAGTC Chr7:28107045..28107064 61.07 55
downstream ENSMUSE00000307031 Chr7:28104644..28104775 ACAAATCGCAGAGCCGTATT Chr7:28104716..28104735 59.74 45
downstream ENSMUSE00000307152 Chr7:28104430..28104555 GCAGATTCTGGCACATAGCA Chr7:28104474..28104493 59.98 50
downstream ENSMUSE00000535649 Chr7:28099256..28099402 CACACGCCCTGTAGTGTCTC Chr7:28099347..28099366 59.34 60
downstream ENSMUSE00000711483 Chr7:28096579..28096831 GAATAGGGGCACGTGTGTAAA Chr7:28096615..28096635 59.88 47.62
downstream ENSMUSE00000535648 Chr7:28095540..28095806 ATTGTCACACGCATCTGGAG Chr7:28095618..28095637 59.71 50
downstream ENSMUSE00000535647 Chr7:28095200..28095271 CCGTGAGGACACAATGACTG Chr7:28095222..28095241 60.15 55
downstream ENSMUSE00000535645 Chr7:28094305..28094433 AAGAGTTGGCATTCGTCCAC Chr7:28094390..28094409 60.12 50
downstream ENSMUSE00000535644 Chr7:28093940..28094086 GCTCGCAGGTACAGTGGTAAG Chr7:28093978..28093998 59.95 57.14
downstream ENSMUSE00000307972 Chr7:28092787..28092939 AGACAGCAGCACTCGGTGTA Chr7:28092818..28092837 59.65 55
downstream ENSMUSE00000307021 Chr7:28091581..28091961 AGGGGTCGTAGGGTAGCACT Chr7:28091772..28091791 60.02 60
downstream ENSMUSE00000307074 Chr7:28091086..28091238 TACCACACTCTTCGGCCTCT Chr7:28091169..28091188 59.87 55
downstream ENSMUSE00000719934 Chr7:28091017..28091238 TACCACACTCTTCGGCCTCT Chr7:28091169..28091188 59.87 55
downstream ENSMUSE00000465029 Chr7:28090161..28090569 GCAAATCCTGGACGACAGAT Chr7:28090442..28090461 60.08 50
downstream ENSMUSE00000709638 Chr7:28090159..28090569 GCAAATCCTGGACGACAGAT Chr7:28090442..28090461 60.08 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGTTGGTTGCGGGAATACT Chr7:28112242..28112262 60.74 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGTTGGTTGCGGGAATACT Chr7:28112242..28112262 60.74 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040488