Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11155
Trapped Gene
Creld1 (ENSMUSG00000030284)
Vector Insertion
Chr 6: 113439785 - 113441646
Public Clones G057D08 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 58% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000197065 (Chr6:113439689..113439784 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAATCCCATTGTCTGCAGTG Chr6:113439727..113439746 59.09 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000197065 (Chr6:113439689..113439784 +)
Downstram Exon
ENSMUSE00000197063 (Chr6:113441647..113441730 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAATCCCATTGTCTGCAGTG Chr6:113439727..113439746 59.09 50 GTGGCTTGCTCTGTACCACA Chr6:113441680..113441699 59.9 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000224405 Chr6:113433554..113434070 GCACTGGTGGACAACTTCAA Chr6:113434047..113434066 59.73 50
upstream ENSMUSE00000197059 Chr6:113434489..113434571 AGAACCATCCGGGACAACTT Chr6:113434498..113434517 60.75 50
upstream ENSMUSE00000197055 Chr6:113438065..113438175 CTGGTGGAAAACTGGTGGTT Chr6:113438150..113438169 59.86 50
upstream ENSMUSE00000197051 Chr6:113438473..113438564 TCTGTTCCGATTCCCTGAAG Chr6:113438505..113438524 60.19 50
upstream ENSMUSE00000197061 Chr6:113439428..113439604 GTGGCCTTGGCTACTTTGAG Chr6:113439551..113439570 59.88 55
upstream ENSMUSE00000197065 Chr6:113439689..113439784 GAATCCCATTGTCTGCAGTG Chr6:113439727..113439746 59.09 50

*** Putative Vector Insertion (Chr 6: 113439785 - 113441646) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000197063 Chr6:113441647..113441730 GTGGCTTGCTCTGTACCACA Chr6:113441680..113441699 59.9 55
downstream ENSMUSE00000197052 Chr6:113441888..113441983 No primer for this exon
downstream ENSMUSE00000197050 Chr6:113442118..113442252 CCCTCCGTGTTTTCACACTT Chr6:113442184..113442203 60.01 50
downstream ENSMUSE00000377202 Chr6:113442681..113443333 TTTCATCCTCCGTCATCTCC Chr6:113442722..113442741 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCCTGCATCACCTCAAGTGT Chr6:113439762..113439782 61.13 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCCTGCATCACCTCAAGTGT Chr6:113439762..113439782 61.13 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030284