Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11158
Trapped Gene
Yars2 (ENSMUSG00000022792)
Vector Insertion
Chr 16: 16303841 - 16304628
Public Clones G059G10 (ggtc)
Private Clones OST437744 (lexicon) OST80899 (lexicon)
Severity of mutation (?) Insertion after 54% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000514361 (Chr16:16303075..16303840 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGCGGAGTTCTTTTACCAG Chr16:16303708..16303727 60.24 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000514361 (Chr16:16303075..16303840 +)
Downstram Exon
ENSMUSE00000520296 (Chr16:16304629..16304796 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGCGGAGTTCTTTTACCAG Chr16:16303708..16303727 60.24 50 CTGTTTAGCCAAACCGCATT Chr16:16304733..16304752 60.13 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000514361 Chr16:16303075..16303840 TGGCGGAGTTCTTTTACCAG Chr16:16303708..16303727 60.24 50

*** Putative Vector Insertion (Chr 16: 16303841 - 16304628) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000520296 Chr16:16304629..16304796 CTGTTTAGCCAAACCGCATT Chr16:16304733..16304752 60.13 45
downstream ENSMUSE00000509987 Chr16:16306556..16306711 GCAACTCGCTTTTCTGGTTC Chr16:16306645..16306664 60 50
downstream ENSMUSE00000130456 Chr16:16307303..16307473 GACCTCCAGTGCCTCTATGC Chr16:16307351..16307370 59.83 60
downstream ENSMUSE00000335313 Chr16:16309425..16309720 TACATTGTGAGGGGCCTTGT Chr16:16309682..16309701 60.38 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCAACATCATGTCTGGCTA Chr16:16303807..16303827 59.68 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCAACATCATGTCTGGCTA Chr16:16303807..16303827 59.68 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022792