Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1117
Trapped Gene
Lrp6 (ENSMUSG00000030201)
Vector Insertion
Chr 6: 134434459 - 134435661
Public Clones CC0361 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000196321 (Chr6:134435662..134435951 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACAATGTGGCCATTCCTCTC Chr6:134435740..134435759 59.93 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000196321 (Chr6:134435662..134435951 -)
Downstram Exon
ENSMUSE00000196327 (Chr6:134434232..134434458 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACAATGTGGCCATTCCTCTC Chr6:134435740..134435759 59.93 50 ACCTCAATGCGATTTGTTCC Chr6:134434297..134434316 59.94 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000689892 Chr6:134516661..134516931 GCGCCCTTTTCTTTCTTCTC Chr6:134516841..134516860 60.45 50
upstream ENSMUSE00000341947 Chr6:134491670..134492063 ATGTCAGCGAAGAAGCCATT Chr6:134491894..134491913 59.84 45
upstream ENSMUSE00000196323 Chr6:134470414..134470611 CAGGAGCGGAAGCTTTACTG Chr6:134470468..134470487 60.15 55
upstream ENSMUSE00000196319 Chr6:134463241..134463437 CATCCTTTTGCCTTGACGTT Chr6:134463390..134463409 60.11 45
upstream ENSMUSE00000196328 Chr6:134461174..134461305 ATGGTGGTTGTTCCCATTTG Chr6:134461262..134461281 60.47 45
upstream ENSMUSE00000196314 Chr6:134457304..134457700 CTTGAGGCGAATTTCTTTGG Chr6:134457644..134457663 59.82 45
upstream ENSMUSE00000196311 Chr6:134456214..134456385 GGACGGATCTGACCGAGTAG Chr6:134456312..134456331 59.68 60
upstream ENSMUSE00000196315 Chr6:134436473..134436689 GGCCACAAGTGTTCACAGAA Chr6:134436479..134436498 59.73 50
upstream ENSMUSE00000196321 Chr6:134435662..134435951 ACAATGTGGCCATTCCTCTC Chr6:134435740..134435759 59.93 50

*** Putative Vector Insertion (Chr 6: 134434459 - 134435661) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000196327 Chr6:134434232..134434458 ACCTCAATGCGATTTGTTCC Chr6:134434297..134434316 59.94 45
downstream ENSMUSE00000196313 Chr6:134430394..134430578 CATTTGCTCGGCCTACATTT Chr6:134430453..134430472 60.1 45
downstream ENSMUSE00000196317 Chr6:134429527..134429853 TCCTGTTGTCAGCATTCAGG Chr6:134429514..134429533 59.83 50
downstream ENSMUSE00000196310 Chr6:134420707..134420909 GTTCCGAAGGCTGTGGATAG Chr6:134420781..134420800 59.69 55
downstream ENSMUSE00000689860 Chr6:134420707..134421311 GTCCAGAACCGTCCTTCAAA Chr6:134421023..134421042 60.09 50
downstream ENSMUSE00000196322 Chr6:134418661..134418872 TGATTTGCGACTGAGTTTGC Chr6:134418816..134418835 59.99 45
downstream ENSMUSE00000196325 Chr6:134417527..134417717 CAGCCCGTTCAATTTTAGGA Chr6:134417643..134417662 60.07 45
downstream ENSMUSE00000196309 Chr6:134414413..134414622 CCAGTTTTCAAACACGGTCA Chr6:134414530..134414549 59.58 45
downstream ENSMUSE00000196312 Chr6:134412554..134412679 CAGCTCATCCTGAAGCAGAA Chr6:134412542..134412561 59.27 50
downstream ENSMUSE00000196329 Chr6:134409250..134409486 CTGGCACACTGGAACTGAGA Chr6:134409308..134409327 60.02 55
downstream ENSMUSE00000196330 Chr6:134407676..134407786 CTTTCCAACGCACTGACCAT Chr6:134407712..134407731 61.1 50
downstream ENSMUSE00000196320 Chr6:134406073..134406303 CGTCTCCCTTCATACGAGGA Chr6:134406147..134406166 60.21 55
downstream ENSMUSE00000196318 Chr6:134404715..134404851 CCCCATGATACTGAGGGAAC Chr6:134404783..134404802 59.21 55
downstream ENSMUSE00000196316 Chr6:134403568..134403665 GATGGTGGTGGGTTCAAAAT Chr6:134403624..134403643 59.51 45
downstream ENSMUSE00000650844 Chr6:134400501..134401098 CCCTCCAGATCTCAACCAGA Chr6:134400712..134400731 60.19 55
downstream ENSMUSE00000689880 Chr6:134400440..134401098 CTTTTATGGCACAAGCAGCA Chr6:134400568..134400587 60.01 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr6:134435591..134435611 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGAATCACAGCGTGACTGG Chr6:134435601..134435621 60.87 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030201