Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11177
Trapped Gene
Tm9sf2 (ENSMUSG00000025544)
Vector Insertion
Chr 14: 122540533 - 122541585
Public Clones G043D05 (ggtc) P077A11 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 41% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000151528 (Chr14:122540421..122540532 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCAACAAGGCTTCAGGAGA Chr14:122540476..122540495 60.13 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000151528 (Chr14:122540421..122540532 +)
Downstram Exon
ENSMUSE00000151522 (Chr14:122541586..122541665 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCAACAAGGCTTCAGGAGA Chr14:122540476..122540495 60.13 50 AGACGCCCATCTGATGTTTT Chr14:122541615..122541634 59.56 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000226256 Chr14:122506304..122506657 CGGTGTCTCCTAGCGTAACC Chr14:122506346..122506365 59.76 60
upstream ENSMUSE00000706402 Chr14:122506490..122506657 CCGAAGAGAAGAGCAACGAG Chr14:122506632..122506651 60.27 55
upstream ENSMUSE00000151519 Chr14:122522938..122523005 GCTTGATTCGGTGGAATCTG Chr14:122522964..122522983 60.6 50
upstream ENSMUSE00000151517 Chr14:122525328..122525421 ACTTTTGCCAAGCGTCAGAA Chr14:122525333..122525352 60.94 45
upstream ENSMUSE00000151524 Chr14:122532502..122532629 No primer for this exon
upstream ENSMUSE00000151516 Chr14:122536594..122536723 CACGTGGTGCTATGAGGTTG Chr14:122536615..122536634 60.17 55
upstream ENSMUSE00000151515 Chr14:122538872..122538996 AACTGGGTCTATGGGAGCAA Chr14:122538946..122538965 59.55 50
upstream ENSMUSE00000151528 Chr14:122540421..122540532 AGCAACAAGGCTTCAGGAGA Chr14:122540476..122540495 60.13 50

*** Putative Vector Insertion (Chr 14: 122540533 - 122541585) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000151522 Chr14:122541586..122541665 AGACGCCCATCTGATGTTTT Chr14:122541615..122541634 59.56 45
downstream ENSMUSE00000151518 Chr14:122542629..122542737 GCGTGCGTAACATAATCATAGC Chr14:122542697..122542718 59.68 45.46
downstream ENSMUSE00000151527 Chr14:122544319..122544451 CCTTTCTTGGAGGACGGAAT Chr14:122544388..122544407 60.43 50
downstream ENSMUSE00000151521 Chr14:122545887..122546006 ACATGTCATCAGGGCTCCTC Chr14:122545945..122545964 60.08 55
downstream ENSMUSE00000226198 Chr14:122547210..122547267 CCACTTTTCACCACCAAAGG Chr14:122547232..122547251 60.38 50
downstream ENSMUSE00000226192 Chr14:122549072..122549231 AACCAGAGTGCCAAAAGGAA Chr14:122549159..122549178 59.71 45
downstream ENSMUSE00000151526 Chr14:122549956..122550107 GATTGGTTCGAACTGGGTGT Chr14:122549986..122550005 59.83 50
downstream ENSMUSE00000151513 Chr14:122551186..122551297 No primer for this exon
downstream ENSMUSE00000151523 Chr14:122554550..122554721 GTACTTGCTGTCCCCGTGAT Chr14:122554668..122554687 60 55
downstream ENSMUSE00000646637 Chr14:122554550..122554600 GTAAGGAAGGAACGCCACTG Chr14:122554584..122554603 59.73 55
downstream ENSMUSE00000646636 Chr14:122554603..122554721 GTACTTGCTGTCCCCGTGAT Chr14:122554668..122554687 60 55
downstream ENSMUSE00000352842 Chr14:122557871..122558825 ACAAAGCCCGACAGTTTCAC Chr14:122558698..122558717 60.16 50
downstream ENSMUSE00000646635 Chr14:122557871..122557961 AACTGGACACACTGGGCTTC Chr14:122557962..122557981 60.16 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr14:122540583..122540603 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTAAACACGTGACTGGGAAAA Chr14:122540577..122540598 58.19 38.1 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025544