Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11178
Trapped Gene
Fat1 (ENSMUSG00000070047)
Vector Insertion
Chr 8: 46127385 - 46127388
Public Clones G043C07 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 55% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000608080 (Chr8:46127234..46127387 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCGTTGTACGTAGGGACGTT Chr8:46127254..46127273 60.06 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000608080 (Chr8:46127234..46127387 +)
Downstram Exon
ENSMUSE00000683875 (Chr8:46127386..46127416 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCGTTGTACGTAGGGACGTT Chr8:46127254..46127273 60.06 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000683877 Chr8:46035568..46038835 GGAGCAGATAACCACCGTGT Chr8:46037325..46037344 60 55
upstream ENSMUSE00000683900 Chr8:46035568..46038835 GGAGCAGATAACCACCGTGT Chr8:46037325..46037344 60 55
upstream ENSMUSE00000637106 Chr8:46074285..46074599 CCACTACTGGCTCACGGTCT Chr8:46074328..46074347 60.32 60
upstream ENSMUSE00000608098 Chr8:46092596..46092657 CTCATCACAACCACGTCGAG Chr8:46092598..46092617 60.31 55
upstream ENSMUSE00000608097 Chr8:46095147..46095479 TTCTCCATCGAACCCAAAAC Chr8:46095405..46095424 59.91 45
upstream ENSMUSE00000637101 Chr8:46095755..46095965 CGTTTGAGGAATCGGTTTTC Chr8:46095852..46095871 59.55 45
upstream ENSMUSE00000637100 Chr8:46098318..46098457 TAAGCCCCTTGATGCAGAAC Chr8:46098376..46098395 60.21 50
upstream ENSMUSE00000608094 Chr8:46102719..46102994 AGCTTGACCATGAAGCCATT Chr8:46102951..46102970 59.7 45
upstream ENSMUSE00000608093 Chr8:46103189..46103399 GAAACGAAACTTTGCCAGGA Chr8:46103212..46103231 60.23 45
upstream ENSMUSE00000637097 Chr8:46108158..46112225 AAGCCGTTCTACAGCCTCAA Chr8:46110719..46110738 60.01 50
upstream ENSMUSE00000637096 Chr8:46112838..46113034 GCAGAGTGACTGGAGGGTGT Chr8:46112875..46112894 60.31 60
upstream ENSMUSE00000683894 Chr8:46114810..46114963 GAAGCTGGTCATGCAGGTCT Chr8:46114851..46114870 60.42 55
upstream ENSMUSE00000637126 Chr8:46115466..46115699 CCTCCTTGATCGTGAGGAAC Chr8:46115485..46115504 59.65 55
upstream ENSMUSE00000637125 Chr8:46116619..46117008 TTCCTACTCGCTGGTCGAAT Chr8:46116635..46116654 59.84 50
upstream ENSMUSE00000637124 Chr8:46118693..46118907 GATAACAGCCCCGTGTTCAG Chr8:46118827..46118846 60.52 55
upstream ENSMUSE00000608088 Chr8:46118709..46118907 GATAACAGCCCCGTGTTCAG Chr8:46118827..46118846 60.52 55
upstream ENSMUSE00000608087 Chr8:46119186..46119323 CAGGGAAGTCCGTTCACAAT Chr8:46119252..46119271 59.97 50
upstream ENSMUSE00000637123 Chr8:46119186..46119323 CAGGGAAGTCCGTTCACAAT Chr8:46119252..46119271 59.97 50
upstream ENSMUSE00000608086 Chr8:46120819..46120962 CGATGTCTCCGATGTCAATG Chr8:46120896..46120915 60.07 50
upstream ENSMUSE00000608085 Chr8:46121473..46121670 ATGAAAACGCCTTTGAGGTG Chr8:46121576..46121595 60.11 45
upstream ENSMUSE00000608084 Chr8:46122030..46122831 GTGACGGACGTTGAGGAAAT Chr8:46122636..46122655 59.97 50
upstream ENSMUSE00000608083 Chr8:46123614..46123745 CCACCATGGGTGTGAAGATA Chr8:46123633..46123652 59.22 50
upstream ENSMUSE00000608082 Chr8:46125154..46125311 CTGAGCATGCGTCTGAGAAC Chr8:46125234..46125253 59.73 55
upstream ENSMUSE00000683886 Chr8:46125154..46125305 CTGAGCATGCGTCTGAGAAC Chr8:46125234..46125253 59.73 55
upstream ENSMUSE00000608081 Chr8:46125888..46126350 CAGAGCATTCAGGTCAACGA Chr8:46125951..46125970 59.98 50
upstream ENSMUSE00000683884 Chr8:46125933..46126350 CAGAGCATTCAGGTCAACGA Chr8:46125951..46125970 59.98 50
upstream ENSMUSE00000608080 Chr8:46127234..46127387 GCGTTGTACGTAGGGACGTT Chr8:46127254..46127273 60.06 55
upstream ENSMUSE00000683876 Chr8:46127234..46127365 GCGTTGTACGTAGGGACGTT Chr8:46127254..46127273 60.06 55
upstream ENSMUSE00000683882 Chr8:46127234..46127380 GCGTTGTACGTAGGGACGTT Chr8:46127254..46127273 60.06 55

*** Putative Vector Insertion (Chr 8: 46127385 - 46127388) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000683875 Chr8:46127386..46127416 No primer for this exon
downstream ENSMUSE00000683880 Chr8:46127517..46127673 GCACCATCCAAACTGTCAAA Chr8:46127640..46127659 59.55 45
downstream ENSMUSE00000608079 Chr8:46127563..46127673 TCCCCTAAAGCCTGAGTCAC Chr8:46127671..46127690 59.28 55
downstream ENSMUSE00000608078 Chr8:46129277..46129908 GAATTGCGGTCAAGGTTGTT Chr8:46129726..46129745 59.98 45
downstream ENSMUSE00000608077 Chr8:46130385..46130522 AAGGAGCTAAGCGACTGCAC Chr8:46130499..46130518 59.79 55
downstream ENSMUSE00000637111 Chr8:46135196..46135231 GTCAGGAGCAGCCAAAGATT Chr8:46135218..46135237 59.43 50
downstream ENSMUSE00000683873 Chr8:46136135..46137590 ACCCGGTCGATTACAGTCAG Chr8:46136963..46136982 59.99 55
downstream ENSMUSE00000683879 Chr8:46136135..46137611 ACCCGGTCGATTACAGTCAG Chr8:46136963..46136982 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CACTGGTCAGAGGCGTGACT Chr8:46127377..46127397 61.5 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000070047