Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11186
Trapped Gene
Scpep1 (ENSMUSG00000000278)
Vector Insertion
Chr 11: 88798366 - 88802597
Public Clones G047H05 (ggtc) E325E12 (ggtc) (ggtc) G073D03 (ggtc) G041A05 (ggtc)
G062F08 (ggtc) (ggtc) IST12340E2 (tigm)
Private Clones OST224554 (lexicon) OST37459 (lexicon)
Severity of mutation (?) Insertion after 46% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000264342 (Chr11:88802598..88802670 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000264342 (Chr11:88802598..88802670 -)
Downstram Exon
ENSMUSE00000264333 (Chr11:88798328..88798365 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000402217 Chr11:88816608..88816743 No primer for this exon
upstream ENSMUSE00000106548 Chr11:88813720..88813868 No primer for this exon
upstream ENSMUSE00000264368 Chr11:88808459..88808548 No primer for this exon
upstream ENSMUSE00000106542 Chr11:88805689..88805844 No primer for this exon
upstream ENSMUSE00000264351 Chr11:88805111..88805185 No primer for this exon
upstream ENSMUSE00000264342 Chr11:88802598..88802670 No primer for this exon

*** Putative Vector Insertion (Chr 11: 88798366 - 88802597) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000264333 Chr11:88798328..88798365 No primer for this exon
downstream ENSMUSE00000264326 Chr11:88797137..88797265 No primer for this exon
downstream ENSMUSE00000106544 Chr11:88795892..88795985 No primer for this exon
downstream ENSMUSE00000106539 Chr11:88794762..88794875 No primer for this exon
downstream ENSMUSE00000106541 Chr11:88791522..88791659 No primer for this exon
downstream ENSMUSE00000106538 Chr11:88790479..88790642 No primer for this exon
downstream ENSMUSE00000403249 Chr11:88785336..88786038 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCTCCCCCGTGGGTAAGTAT Chr11:88799588..88799608 60.57 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTCCCCCGTGGGTAAGTAT Chr11:88799588..88799608 60.57 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CTGGGGTTGCTTTGGTAATC Chr11:88799615..88799635 59.43 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GTGCAACTTTTCTGGGGTTG Chr11:88799626..88799646 60.53 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000000278