Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI112
Trapped Gene
Socs7 (ENSMUSG00000038485)
Vector Insertion
Chr 11: 97237856 - 97238310
Public Clones GC0041 (tigem)
Private Clones not available
Severity of mutation (?) Insertion after 55% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000286708 (Chr11:97237751..97237855 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGTATCGCTTGTGGACGTG Chr11:97237757..97237776 60.32 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000286708 (Chr11:97237751..97237855 +)
Downstram Exon
ENSMUSE00000286697 (Chr11:97238311..97238412 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGTATCGCTTGTGGACGTG Chr11:97237757..97237776 60.32 55 GGGAAAGACTGCAAGGAAGA Chr11:97238383..97238402 59.4 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000379250 Chr11:97223865..97224737 GAAGGGCTCCTTCAAAATCC Chr11:97224567..97224586 60.02 50
upstream ENSMUSE00000286717 Chr11:97234380..97234444 CCCAGGTTGACAAGAACTCAA Chr11:97234384..97234404 60.13 47.62
upstream ENSMUSE00000286708 Chr11:97237751..97237855 CAGTATCGCTTGTGGACGTG Chr11:97237757..97237776 60.32 55

*** Putative Vector Insertion (Chr 11: 97237856 - 97238310) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000286697 Chr11:97238311..97238412 GGGAAAGACTGCAAGGAAGA Chr11:97238383..97238402 59.4 50
downstream ENSMUSE00000286688 Chr11:97239250..97239380 GGATTCTGACGCTCTGATGG Chr11:97239293..97239312 60.77 55
downstream ENSMUSE00000286682 Chr11:97239857..97240025 GGCTCAGGATGTAACGAGGA Chr11:97239974..97239993 60.22 55
downstream ENSMUSE00000286675 Chr11:97244214..97244342 ACAGCGATCCTCAAACTTGG Chr11:97244260..97244279 60.26 50
downstream ENSMUSE00000286667 Chr11:97250426..97250561 ATCCGGAATCTGCAAAGATG Chr11:97250516..97250535 60.04 45
downstream ENSMUSE00000286660 Chr11:97250880..97251030 AATGAGCTGCGCTTCCTTTA Chr11:97250967..97250986 60.12 45
downstream ENSMUSE00000383143 Chr11:97254703..97259856 AAGACATGGGTCGGTACAGC Chr11:97259811..97259830 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCCTCCTCCTCCAAGAAGAA Chr11:97237822..97237842 60.69 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGTCGTGACTGGGAAAACC Chr11:97237903..97237923 60.41 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038485