Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11200
Trapped Gene
Pcmt1 (ENSMUSG00000019795)
Vector Insertion
Chr 10: 7364228 - 7367387
Public Clones (sanger) G040A07 (ggtc)
Private Clones OST360921 (lexicon)
Severity of mutation (?) Insertion after 29% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000644988 (Chr10:7367388..7367419 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000644988 (Chr10:7367388..7367419 -)
Downstram Exon
ENSMUSE00000644987 (Chr10:7364123..7364227 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000616530 Chr10:7382873..7383048 No primer for this exon
upstream ENSMUSE00000323238 Chr10:7368849..7368953 No primer for this exon
upstream ENSMUSE00000644988 Chr10:7367388..7367419 No primer for this exon

*** Putative Vector Insertion (Chr 10: 7364228 - 7367387) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000644987 Chr10:7364123..7364227 No primer for this exon
downstream ENSMUSE00000644986 Chr10:7360493..7360613 No primer for this exon
downstream ENSMUSE00000644985 Chr10:7359843..7359928 No primer for this exon
downstream ENSMUSE00000666804 Chr10:7357848..7358023 No primer for this exon
downstream ENSMUSE00000355412 Chr10:7357807..7358023 No primer for this exon
downstream ENSMUSE00000666802 Chr10:7357741..7357744 No primer for this exon
downstream ENSMUSE00000616525 Chr10:7349986..7350774 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr10:7364317..7364337 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGGGCACATGTCACTCAAG Chr10:7364336..7364356 60.31 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CCCCGTTTTTAACCTTGTGA Chr10:7364444..7364464 59.83 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CCCCGTTTTTAACCTTGTGA Chr10:7364444..7364464 59.83 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000019795