Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11204
Trapped Gene
Psap (ENSMUSG00000004207)
Vector Insertion
Chr 10: 59740531 - 59754386
Public Clones G085E10 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000666343 (Chr10:59740375..59740530 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000666343 (Chr10:59740375..59740530 +)
Downstram Exon
ENSMUSE00000279514 (Chr10:59754387..59754520 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000666343 Chr10:59740375..59740530 No primer for this exon
upstream ENSMUSE00000376967 Chr10:59740461..59740530 No primer for this exon

*** Putative Vector Insertion (Chr 10: 59740531 - 59754386) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000279514 Chr10:59754387..59754520 No primer for this exon
downstream ENSMUSE00000100655 Chr10:59755253..59755327 No primer for this exon
downstream ENSMUSE00000100659 Chr10:59756097..59756222 No primer for this exon
downstream ENSMUSE00000100652 Chr10:59757281..59757478 No primer for this exon
downstream ENSMUSE00000100658 Chr10:59757713..59757856 No primer for this exon
downstream ENSMUSE00000100661 Chr10:59758694..59758750 No primer for this exon
downstream ENSMUSE00000666344 Chr10:59760285..59760293 No primer for this exon
downstream ENSMUSE00000100657 Chr10:59761846..59761977 No primer for this exon
downstream ENSMUSE00000100651 Chr10:59762212..59762307 No primer for this exon
downstream ENSMUSE00000100660 Chr10:59762527..59762806 No primer for this exon
downstream ENSMUSE00000100653 Chr10:59762896..59763053 No primer for this exon
downstream ENSMUSE00000100656 Chr10:59763286..59763366 No primer for this exon
downstream ENSMUSE00000100654 Chr10:59763522..59763629 No primer for this exon
downstream ENSMUSE00000413378 Chr10:59764442..59765342 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTCTCGGGCTGTAATCCTTG Chr10:59743527..59743547 59.69 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGCTTGCTTGGTTTTGGTT Chr10:59743532..59743552 60.28 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000004207