Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11215
Trapped Gene
Manba (ENSMUSG00000028164)
Vector Insertion
Chr 3: 135174938 - 135180866
Public Clones G037E08 (ggtc) IST10211A4 (tigm) IST10433H9 (tigm) IST12930C3 (tigm)
IST10211A4 (tigm) IST12228A8 (tigm) IST12228A8 (tigm) IST11849F2 (tigm)
IST10062C3 (tigm) IST10064C10 (tigm)
Private Clones OST285991 (lexicon) OST197187 (lexicon) OST191046 (lexicon) OST191017 (lexicon)
Severity of mutation (?) Insertion after 21% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000242240 (Chr3:135174767..135174937 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CACGTCAACTTCATCCGAAA Chr3:135174917..135174936 59.69 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000242240 (Chr3:135174767..135174937 +)
Downstram Exon
ENSMUSE00000242234 (Chr3:135180867..135180990 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CACGTCAACTTCATCCGAAA Chr3:135174917..135174936 59.69 45 AGATTCCCTGAGAGGGGAAG Chr3:135180924..135180943 59.63 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000242269 Chr3:135148578..135148821 AGCATGCATCTTCACCTGCT Chr3:135148642..135148661 60.98 50
upstream ENSMUSE00000242259 Chr3:135169873..135169967 GGACCTACAGCACGGAATTT Chr3:135169928..135169947 59.06 50
upstream ENSMUSE00000242249 Chr3:135173939..135174044 GACACGGTTGCAGAAATCCT Chr3:135173976..135173995 60.12 50
upstream ENSMUSE00000242240 Chr3:135174767..135174937 CACGTCAACTTCATCCGAAA Chr3:135174917..135174936 59.69 45

*** Putative Vector Insertion (Chr 3: 135174938 - 135180866) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000242234 Chr3:135180867..135180990 AGATTCCCTGAGAGGGGAAG Chr3:135180924..135180943 59.63 55
downstream ENSMUSE00000242226 Chr3:135185956..135186131 TTGAGGGATGGCTACTGTCA Chr3:135186056..135186075 59.24 50
downstream ENSMUSE00000176937 Chr3:135187481..135187591 CCTCCATCCAGAGCAAAGAG Chr3:135187569..135187588 59.94 55
downstream ENSMUSE00000176926 Chr3:135205276..135205427 AGTCGGCTGGAATCCAATTT Chr3:135205402..135205421 60.83 45
downstream ENSMUSE00000176931 Chr3:135207690..135207807 GAGTGTTCATGTTCGCATCC Chr3:135207739..135207758 59.09 50
downstream ENSMUSE00000446365 Chr3:135210514..135210600 TTTCCTCACGGAGGCTAAGA Chr3:135210588..135210607 59.95 50
downstream ENSMUSE00000176940 Chr3:135212164..135212331 ATGTCCCTGGGATTTACGTG Chr3:135212270..135212289 59.67 50
downstream ENSMUSE00000500705 Chr3:135214027..135214245 TGAAAGGACGGCTCTTGTCT Chr3:135214051..135214070 59.99 50
downstream ENSMUSE00000176942 Chr3:135217724..135217888 GGAGAAGCGGCTGTTGTAAG Chr3:135217768..135217787 60.01 55
downstream ENSMUSE00000414334 Chr3:135226169..135226313 GGCCTTTTCCGTCCACTATC Chr3:135226250..135226269 60.83 55
downstream ENSMUSE00000445781 Chr3:135229452..135229594 AACAGTGGAGCGAAGAAACG Chr3:135229515..135229534 60.43 50
downstream ENSMUSE00000242177 Chr3:135230428..135230685 CTCCGGCCTTAACCACAATA Chr3:135230506..135230525 59.95 50
downstream ENSMUSE00000414715 Chr3:135233179..135234293 AGTCTTCTGGCCGTGCTTTA Chr3:135233641..135233660 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGAGCAGAAGGGTGAATGTC Chr3:135174899..135174919 59.66 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAGCAGAAGGGTGAATGTC Chr3:135174899..135174919 59.66 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028164