Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11227
Trapped Gene
Gpc3 (ENSMUSG00000055653)
Vector Insertion
Chr X: 49740840 - 49741412
Public Clones G033G09 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 74% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000436226 (ChrX:49741286..49741411 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGCTGGAACGGACAAGAACT ChrX:49741295..49741314 60.83 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000436226 (ChrX:49741286..49741411 -)
Downstram Exon
ENSMUSE00000700805 (ChrX:49740841..49741411 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGCTGGAACGGACAAGAACT ChrX:49741295..49741314 60.83 50 CGGCAAAGCGCTATAGAAGT ChrX:49741338..49741357 59.65 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000520286 ChrX:49966810..49967127 TCTTGCTCTGTCGGGCTACT ChrX:49967062..49967081 60.16 55
upstream ENSMUSE00000719933 ChrX:49966810..49967127 TCTTGCTCTGTCGGGCTACT ChrX:49967062..49967081 60.16 55
upstream ENSMUSE00000436250 ChrX:49935974..49936135 TGCTCCAGTCTGCGAGTATG ChrX:49936017..49936036 60.16 55
upstream ENSMUSE00000436236 ChrX:49781617..49782311 TGCTCTTACTGCCAGGGACT ChrX:49781846..49781865 60.01 55
upstream ENSMUSE00000436230 ChrX:49750250..49750383 CCCAGCAACGCCAATATAGA ChrX:49750342..49750361 60.98 50
upstream ENSMUSE00000436226 ChrX:49741286..49741411 TGCTGGAACGGACAAGAACT ChrX:49741295..49741314 60.83 50
upstream ENSMUSE00000700805 ChrX:49740841..49741411 TGCTGGAACGGACAAGAACT ChrX:49741295..49741314 60.83 50

*** Putative Vector Insertion (Chr X: 49740840 - 49741412) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000436223 ChrX:49718899..49719019 CTGATTCTTCATCCCGTTCC ChrX:49718958..49718977 59.48 50
downstream ENSMUSE00000436221 ChrX:49668014..49668173 GGAAGCGCAGTTGATTCTTC ChrX:49667998..49668017 59.96 50
downstream ENSMUSE00000624027 ChrX:49625610..49626131 AGGTGGTGATCTCGTTGTCC ChrX:49626029..49626048 59.97 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGTGCTCACTTGCCTCTGA ChrX:49741437..49741457 60.33 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCTATAGCGCTTTGCGTGA ChrX:49741356..49741376 59.75 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000055653