Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11230
Trapped Gene
Adam19 (ENSMUSG00000011256)
Vector Insertion
Chr 11: 45935089 - 45936594
Public Clones G033A09 (ggtc) IST10002G4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 33% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000104343 (Chr11:45934922..45935088 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000104343 (Chr11:45934922..45935088 +)
Downstram Exon
ENSMUSE00000104360 (Chr11:45936595..45936679 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000679628 Chr11:45869489..45869712 No primer for this exon
upstream ENSMUSE00000248605 Chr11:45869587..45869712 No primer for this exon
upstream ENSMUSE00000248599 Chr11:45874425..45874510 No primer for this exon
upstream ENSMUSE00000679625 Chr11:45874425..45874852 No primer for this exon
upstream ENSMUSE00000104348 Chr11:45878514..45878584 No primer for this exon
upstream ENSMUSE00000104363 Chr11:45907365..45907443 No primer for this exon
upstream ENSMUSE00000104327 Chr11:45913355..45913431 No primer for this exon
upstream ENSMUSE00000104368 Chr11:45926259..45926451 No primer for this exon
upstream ENSMUSE00000104331 Chr11:45927125..45927190 No primer for this exon
upstream ENSMUSE00000104330 Chr11:45931922..45931993 No primer for this exon
upstream ENSMUSE00000104343 Chr11:45934922..45935088 No primer for this exon

*** Putative Vector Insertion (Chr 11: 45935089 - 45936594) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000104360 Chr11:45936595..45936679 No primer for this exon
downstream ENSMUSE00000104370 Chr11:45938510..45938649 No primer for this exon
downstream ENSMUSE00000104358 Chr11:45940748..45940925 No primer for this exon
downstream ENSMUSE00000484177 Chr11:45942288..45942377 No primer for this exon
downstream ENSMUSE00000104369 Chr11:45945125..45945320 No primer for this exon
downstream ENSMUSE00000248522 Chr11:45947930..45948038 No primer for this exon
downstream ENSMUSE00000104340 Chr11:45949750..45949963 No primer for this exon
downstream ENSMUSE00000104329 Chr11:45950866..45950943 No primer for this exon
downstream ENSMUSE00000104345 Chr11:45951042..45951150 No primer for this exon
downstream ENSMUSE00000104356 Chr11:45952339..45952477 No primer for this exon
downstream ENSMUSE00000104351 Chr11:45953195..45953279 No primer for this exon
downstream ENSMUSE00000104347 Chr11:45953508..45953732 No primer for this exon
downstream ENSMUSE00000104350 Chr11:45956421..45956573 No primer for this exon
downstream ENSMUSE00000335467 Chr11:45957294..45960845 No primer for this exon
downstream ENSMUSE00000679624 Chr11:45958305..45959138 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCCATGACAATGCTCAGCTA Chr11:45935065..45935085 59.98 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCCATGACAATGCTCAGCTA Chr11:45935065..45935085 59.98 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000011256