Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11247
Trapped Gene
Fgfr1 (ENSMUSG00000031565)
Vector Insertion
Chr 8: 26642752 - 26642901
Public Clones G026F12 (ggtc) (ggtc) G019C04 (ggtc) P014D05 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000710039 (Chr8:26642722..26642900 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCAACCTCTAACCGCAGAAC Chr8:26642786..26642805 59.73 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000710039 (Chr8:26642722..26642900 +)
Downstram Exon
ENSMUSE00000720184 (Chr8:26642753..26642900 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCAACCTCTAACCGCAGAAC Chr8:26642786..26642805 59.73 55 ATCCCAGTTCTGCGGTTAGA Chr8:26642814..26642833 59.69 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000684681 Chr8:26629244..26629901 CCGGACTGGACTGAGACTGT Chr8:26629401..26629420 60.31 60
upstream ENSMUSE00000708961 Chr8:26629264..26629901 CCGGACTGGACTGAGACTGT Chr8:26629401..26629420 60.31 60
upstream ENSMUSE00000715929 Chr8:26629267..26629901 CCGGACTGGACTGAGACTGT Chr8:26629401..26629420 60.31 60
upstream ENSMUSE00000712953 Chr8:26629791..26629901 No primer for this exon
upstream ENSMUSE00000368001 Chr8:26642722..26642900 CCAACCTCTAACCGCAGAAC Chr8:26642786..26642805 59.73 55
upstream ENSMUSE00000710039 Chr8:26642722..26642900 CCAACCTCTAACCGCAGAAC Chr8:26642786..26642805 59.73 55

*** Putative Vector Insertion (Chr 8: 26642752 - 26642901) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000720184 Chr8:26642753..26642900 ATCCCAGTTCTGCGGTTAGA Chr8:26642814..26642833 59.69 50
downstream ENSMUSE00000210796 Chr8:26665944..26666246 CCAGTTGATGCTCTGCACAT Chr8:26666089..26666108 59.86 50
downstream ENSMUSE00000710493 Chr8:26665980..26666246 CCAGTTGATGCTCTGCACAT Chr8:26666089..26666108 59.86 50
downstream ENSMUSE00000514872 Chr8:26668203..26668292 CCTACGGTTTGGTTTGGTGT Chr8:26668294..26668313 59.75 50
downstream ENSMUSE00000684676 Chr8:26668203..26668286 GGTTTGGTGTTGTCCGTCTC Chr8:26668284..26668303 60.41 55
downstream ENSMUSE00000210804 Chr8:26668543..26668715 ATTCGGTGGTCAGGCTTAAA Chr8:26668705..26668724 59.57 45
downstream ENSMUSE00000210814 Chr8:26671192..26671315 CCACGATGCAGGTGTAGTTG Chr8:26671270..26671289 60.17 55
downstream ENSMUSE00000523250 Chr8:26672610..26672800 TTCACCTCGATGTGCTTCAG Chr8:26672754..26672773 59.98 50
downstream ENSMUSE00000715252 Chr8:26673846..26673996 ACACACATACTCCCCGCTCT Chr8:26673929..26673948 59.6 55
downstream ENSMUSE00000523249 Chr8:26674812..26674956 ATAGAGTTACCCGCCAAGCA Chr8:26674918..26674937 59.73 50
downstream ENSMUSE00000210792 Chr8:26677183..26677385 TGGAAGTCGCTCTTCTTGGT Chr8:26677330..26677349 59.99 50
downstream ENSMUSE00000711525 Chr8:26677183..26677379 TGGAAGTCGCTCTTCTTGGT Chr8:26677330..26677349 59.99 50
downstream ENSMUSE00000716690 Chr8:26678288..26678293 No primer for this exon
downstream ENSMUSE00000253494 Chr8:26678660..26678805 AACCAGGAGAACCCCAGAGT Chr8:26678710..26678729 59.97 55
downstream ENSMUSE00000210806 Chr8:26680111..26680232 CACGGTTGGGTTTGTCCTTA Chr8:26680205..26680224 60.78 50
downstream ENSMUSE00000210795 Chr8:26680613..26680723 CGAGATCAGATCCGACAGGT Chr8:26680653..26680672 60.22 55
downstream ENSMUSE00000523247 Chr8:26681182..26681372 CCTCCGGGCCTGTAGATACT Chr8:26681252..26681271 60.48 60
downstream ENSMUSE00000253463 Chr8:26682810..26682932 AGCCAAAGTCTGCGATCTTC Chr8:26682888..26682907 59.58 50
downstream ENSMUSE00000523246 Chr8:26683191..26683261 GGTGTGTGTAGATCCGGTCA Chr8:26683254..26683273 59.39 55
downstream ENSMUSE00000210794 Chr8:26683595..26683732 GAGCCACCCAGAGTGAAGAT Chr8:26683645..26683664 59.26 55
downstream ENSMUSE00000523245 Chr8:26684018..26684123 CCACCAACTGCTTGAACGTA Chr8:26684088..26684107 59.76 50
downstream ENSMUSE00000608945 Chr8:26684217..26686186 TTGAGTGGTGTGGGTTTGAA Chr8:26685823..26685842 59.98 45
downstream ENSMUSE00000710211 Chr8:26684217..26685253 TTGAGTCCACTGTTGGCAAG Chr8:26684386..26684405 59.87 50
downstream ENSMUSE00000711336 Chr8:26684217..26685049 TTGAGTCCACTGTTGGCAAG Chr8:26684386..26684405 59.87 50
downstream ENSMUSE00000718819 Chr8:26684217..26684393 GTACTGGTCCAGCGGTATGG Chr8:26684255..26684274 60.4 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr8:26642802..26642822 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAGGTACGGAGCCTTGTTA Chr8:26642767..26642787 59.19 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031565