Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11248
Trapped Gene
Sppl3 (ENSMUSG00000029550)
Vector Insertion
Chr 5: 115538996 - 115545059
Public Clones G086D09 (ggtc) IST14803A6 (tigm) IST14803A6 (tigm)
Private Clones OST335548 (lexicon)
Severity of mutation (?) Insertion after 67% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000189985 (Chr5:115538832..115538995 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTGATGTTCCTCGCCTGTCT Chr5:115538950..115538969 60.27 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000189985 (Chr5:115538832..115538995 +)
Downstram Exon
ENSMUSE00000189997 (Chr5:115545060..115545259 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTGATGTTCCTCGCCTGTCT Chr5:115538950..115538969 60.27 55 GGGTGCAGTGGAAGTAGGAG Chr5:115545244..115545263 59.72 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000594791 Chr5:115461533..115461624 GGCGGAACAGACCTATTCGT Chr5:115461604..115461623 61.4 55
upstream ENSMUSE00000690573 Chr5:115511188..115511211 No primer for this exon
upstream ENSMUSE00000189991 Chr5:115511571..115511648 TGGACTCCAGTCAAGTGTCG Chr5:115511585..115511604 59.86 55
upstream ENSMUSE00000690572 Chr5:115511572..115511648 TGGACTCCAGTCAAGTGTCG Chr5:115511585..115511604 59.86 55
upstream ENSMUSE00000268808 Chr5:115524824..115524912 TCTTTCAATGGCAACAGCAC Chr5:115524885..115524904 59.85 45
upstream ENSMUSE00000189982 Chr5:115532230..115532349 GCATCCAGACCATTGATTCC Chr5:115532230..115532249 60.29 50
upstream ENSMUSE00000189999 Chr5:115533434..115533512 CTCCCGATGTGCCAGTATTT Chr5:115533466..115533485 59.96 50
upstream ENSMUSE00000189994 Chr5:115534862..115534974 GTCTGTCATGCTCGTCCTCA Chr5:115534919..115534938 59.99 55
upstream ENSMUSE00000189980 Chr5:115538299..115538405 TGCTTCTCTCAGGGCTTCTC Chr5:115538368..115538387 59.83 55
upstream ENSMUSE00000189985 Chr5:115538832..115538995 GTGATGTTCCTCGCCTGTCT Chr5:115538950..115538969 60.27 55

*** Putative Vector Insertion (Chr 5: 115538996 - 115545059) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000189997 Chr5:115545060..115545259 GGGTGCAGTGGAAGTAGGAG Chr5:115545244..115545263 59.72 60
downstream ENSMUSE00000189988 Chr5:115545855..115545964 TTAGGTAGGCCATGGTGAGG Chr5:115545965..115545984 59.95 55
downstream ENSMUSE00000348997 Chr5:115547135..115548799 CCAAGTGTGAGGTGATGGTG Chr5:115548573..115548592 60 55
downstream ENSMUSE00000690571 Chr5:115547135..115548262 CTATCAGTTCAGCGCATCCA Chr5:115548056..115548075 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AACGTGTGTAATCGCCTTGC Chr5:115542039..115542059 61.09 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGATGTTCCTCGCCTGTCT Chr5:115538951..115538971 60.27 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029550