Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11253
Trapped Gene
Lrp6 (ENSMUSG00000030201)
Vector Insertion
Chr 6: 134492064 - 134516660
Public Clones G023C12 (ggtc)
Private Clones OST381683 (lexicon) OST346247 (lexicon) OST309546 (lexicon) OST308190 (lexicon)
OST297894 (lexicon) OST262755 (lexicon) OST108592 (lexicon) OST52514 (lexicon)
OST38808 (lexicon)
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000689892 (Chr6:134516661..134516931 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCGCCCTTTTCTTTCTTCTC Chr6:134516841..134516860 60.45 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000689892 (Chr6:134516661..134516931 -)
Downstram Exon
ENSMUSE00000341947 (Chr6:134491670..134492063 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCGCCCTTTTCTTTCTTCTC Chr6:134516841..134516860 60.45 50 AATGGCTTCTTCGCTGACAT Chr6:134491872..134491891 59.84 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000689892 Chr6:134516661..134516931 GCGCCCTTTTCTTTCTTCTC Chr6:134516841..134516860 60.45 50

*** Putative Vector Insertion (Chr 6: 134492064 - 134516660) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000341947 Chr6:134491670..134492063 AATGGCTTCTTCGCTGACAT Chr6:134491872..134491891 59.84 45
downstream ENSMUSE00000196323 Chr6:134470414..134470611 CAGTAAAGCTTCCGCTCCTG Chr6:134470446..134470465 60.15 55
downstream ENSMUSE00000196319 Chr6:134463241..134463437 AACGTCAAGGCAAAAGGATG Chr6:134463368..134463387 60.11 45
downstream ENSMUSE00000196328 Chr6:134461174..134461305 TTGGGCAAGCACACTGATAA Chr6:134461194..134461213 60.26 45
downstream ENSMUSE00000196314 Chr6:134457304..134457700 GGCATGCCGGATATCTTCTA Chr6:134457569..134457588 60.02 50
downstream ENSMUSE00000196311 Chr6:134456214..134456385 GCAGCTCGCTCTATTTTTGG Chr6:134456313..134456332 60.12 50
downstream ENSMUSE00000196315 Chr6:134436473..134436689 GCGCTCCGTTTGTGTACTCT Chr6:134436525..134436544 60.46 55
downstream ENSMUSE00000196321 Chr6:134435662..134435951 ATGCGTCTGATATCCGCTCT Chr6:134435758..134435777 59.83 50
downstream ENSMUSE00000196327 Chr6:134434232..134434458 ACCTCAATGCGATTTGTTCC Chr6:134434297..134434316 59.94 45
downstream ENSMUSE00000196313 Chr6:134430394..134430578 CATTTGCTCGGCCTACATTT Chr6:134430453..134430472 60.1 45
downstream ENSMUSE00000196317 Chr6:134429527..134429853 TCCTGTTGTCAGCATTCAGG Chr6:134429514..134429533 59.83 50
downstream ENSMUSE00000196310 Chr6:134420707..134420909 GTTCCGAAGGCTGTGGATAG Chr6:134420781..134420800 59.69 55
downstream ENSMUSE00000689860 Chr6:134420707..134421311 GTCCAGAACCGTCCTTCAAA Chr6:134421023..134421042 60.09 50
downstream ENSMUSE00000196322 Chr6:134418661..134418872 TGATTTGCGACTGAGTTTGC Chr6:134418816..134418835 59.99 45
downstream ENSMUSE00000196325 Chr6:134417527..134417717 CAGCCCGTTCAATTTTAGGA Chr6:134417643..134417662 60.07 45
downstream ENSMUSE00000196309 Chr6:134414413..134414622 CCAGTTTTCAAACACGGTCA Chr6:134414530..134414549 59.58 45
downstream ENSMUSE00000196312 Chr6:134412554..134412679 CAGCTCATCCTGAAGCAGAA Chr6:134412542..134412561 59.27 50
downstream ENSMUSE00000196329 Chr6:134409250..134409486 CTGGCACACTGGAACTGAGA Chr6:134409308..134409327 60.02 55
downstream ENSMUSE00000196330 Chr6:134407676..134407786 CTTTCCAACGCACTGACCAT Chr6:134407712..134407731 61.1 50
downstream ENSMUSE00000196320 Chr6:134406073..134406303 CGTCTCCCTTCATACGAGGA Chr6:134406147..134406166 60.21 55
downstream ENSMUSE00000196318 Chr6:134404715..134404851 CCCCATGATACTGAGGGAAC Chr6:134404783..134404802 59.21 55
downstream ENSMUSE00000196316 Chr6:134403568..134403665 GATGGTGGTGGGTTCAAAAT Chr6:134403624..134403643 59.51 45
downstream ENSMUSE00000650844 Chr6:134400501..134401098 CCCTCCAGATCTCAACCAGA Chr6:134400712..134400731 60.19 55
downstream ENSMUSE00000689880 Chr6:134400440..134401098 CTTTTATGGCACAAGCAGCA Chr6:134400568..134400587 60.01 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTGTGTGTGCATGTGTAAGCA Chr6:134501620..134501641 59.81 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GACGTTCGTGACTGGGAAAA Chr6:134501595..134501615 61.08 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030201