Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11254
Trapped Gene
Sorl1 (ENSMUSG00000049313)
Vector Insertion
Chr 9: 41832553 - 41838961
Public Clones G082B02 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 46% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000454567 (Chr9:41838962..41839100 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGGATGACTGGTCACAGCTC Chr9:41839068..41839087 60.69 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000454567 (Chr9:41838962..41839100 -)
Downstram Exon
ENSMUSE00000454562 (Chr9:41832379..41832552 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGGATGACTGGTCACAGCTC Chr9:41839068..41839087 60.69 60 AGTAGACTGCAGGGCTGAGG Chr9:41832494..41832513 59.62 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000454738 Chr9:41931912..41932372 CTTTCCTATTCGCCCTGGTC Chr9:41932140..41932159 60.95 55
upstream ENSMUSE00000454712 Chr9:41914511..41914627 CAACGTGATCGTGGCATTAG Chr9:41914552..41914571 60.13 50
upstream ENSMUSE00000454703 Chr9:41907228..41907353 ACAGCGAAGCTGTGATCTCC Chr9:41907261..41907280 60.56 55
upstream ENSMUSE00000454686 Chr9:41900392..41900553 ACAGGTCTCACCCCAACAAG Chr9:41900395..41900414 60 55
upstream ENSMUSE00000454679 Chr9:41898028..41898095 CAGATGATTTTGGCCAGACC Chr9:41898066..41898085 60.46 50
upstream ENSMUSE00000454673 Chr9:41889871..41890051 TTTCAGCTTCGCGACAAGTA Chr9:41889893..41889912 59.75 45
upstream ENSMUSE00000454658 Chr9:41880328..41880429 AGAGCAGCCCAGTTTGTCAC Chr9:41880344..41880363 60.45 55
upstream ENSMUSE00000454647 Chr9:41879155..41879324 AGGACCAGGTGTTCGTGTGT Chr9:41879280..41879299 60.48 55
upstream ENSMUSE00000454640 Chr9:41875880..41876072 TGCCACCCTGATTAATGGTT Chr9:41875990..41876009 60.19 45
upstream ENSMUSE00000454633 Chr9:41872070..41872187 CCGGTCTCATCATTGCTACC Chr9:41872071..41872090 60.48 55
upstream ENSMUSE00000454627 Chr9:41871798..41871871 GCCAGCAAGACCAATGTGTA Chr9:41871832..41871851 59.72 50
upstream ENSMUSE00000454622 Chr9:41865354..41865442 ATGGAGACCAACGAGCTGAA Chr9:41865354..41865373 60.8 50
upstream ENSMUSE00000454618 Chr9:41854566..41854744 GAGCACCGTCTTCACCATCT Chr9:41854632..41854651 60.27 55
upstream ENSMUSE00000454607 Chr9:41851990..41852176 CCAGTGGTTGTGTCCAACTG Chr9:41852017..41852036 60.04 55
upstream ENSMUSE00000454603 Chr9:41849647..41849775 CCTTGTCCTGTGGGTTCTTC Chr9:41849665..41849684 59.55 55
upstream ENSMUSE00000454597 Chr9:41849076..41849161 AGTGGAGGAGACGTTGAAGC Chr9:41849114..41849133 59.46 55
upstream ENSMUSE00000454594 Chr9:41845132..41845304 TGGCCCTGGACTTTGACTAT Chr9:41845180..41845199 59.55 50
upstream ENSMUSE00000454588 Chr9:41843526..41843657 GGCAGGAGGTGATCATCAAT Chr9:41843613..41843632 59.89 50
upstream ENSMUSE00000454582 Chr9:41841648..41841739 CCAGATGGTGACTTCCGACT Chr9:41841711..41841730 60.11 55
upstream ENSMUSE00000454578 Chr9:41839752..41839998 AGCAGCGTTCAGTCATCCTT Chr9:41839791..41839810 60.02 50
upstream ENSMUSE00000454567 Chr9:41838962..41839100 GGGATGACTGGTCACAGCTC Chr9:41839068..41839087 60.69 60

*** Putative Vector Insertion (Chr 9: 41832553 - 41838961) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000454562 Chr9:41832379..41832552 AGTAGACTGCAGGGCTGAGG Chr9:41832494..41832513 59.62 60
downstream ENSMUSE00000454557 Chr9:41830419..41830532 AGCGATACTGGTTTCGGAGA Chr9:41830481..41830500 59.84 50
downstream ENSMUSE00000454549 Chr9:41826199..41826321 CCGGAACTGAGTGTCTGCAT Chr9:41826265..41826284 61.28 55
downstream ENSMUSE00000454544 Chr9:41822538..41822657 TGAACTCGTCGCTACGACAC Chr9:41822606..41822625 60.06 55
downstream ENSMUSE00000454538 Chr9:41816262..41816387 GGATCTTCGTCAGAGCCATC Chr9:41816251..41816270 59.77 55
downstream ENSMUSE00000454532 Chr9:41813889..41813996 CATCACAATGCTTGCTGGAC Chr9:41813909..41813928 60.27 50
downstream ENSMUSE00000337086 Chr9:41812069..41812200 GCTGACGGTTCTTACACACG Chr9:41812131..41812150 59.37 55
downstream ENSMUSE00000454522 Chr9:41810637..41810768 ACAGTTGGCCTCGTCAGAGT Chr9:41810616..41810635 59.91 55
downstream ENSMUSE00000276237 Chr9:41809554..41809688 TCCCCACAGTCGTTCTCTCT Chr9:41809558..41809577 59.83 55
downstream ENSMUSE00000454510 Chr9:41808327..41808482 GGGGAGGGTAGAACATGTGA Chr9:41808439..41808458 59.78 55
downstream ENSMUSE00000454503 Chr9:41804254..41804403 GAACTCAAATCGGTCGCACT Chr9:41804323..41804342 60.26 50
downstream ENSMUSE00000454495 Chr9:41800387..41800518 TGCTCGTACAGGTCAAGGTG Chr9:41800467..41800486 59.9 55
downstream ENSMUSE00000454491 Chr9:41799702..41799828 CTCCGGAGAAATCAGCTGTC Chr9:41799750..41799769 59.95 55
downstream ENSMUSE00000454485 Chr9:41799395..41799564 GGAGTCCTGAGGGTCACAAA Chr9:41799381..41799400 60.09 55
downstream ENSMUSE00000474786 Chr9:41797437..41797549 CCGAGAATCACACCTTCCTC Chr9:41797464..41797483 59.65 55
downstream ENSMUSE00000454043 Chr9:41796788..41796892 ACATCTTGGACCCACTCCTG Chr9:41796840..41796859 59.96 55
downstream ENSMUSE00000454037 Chr9:41795549..41795621 TCCAGTTTCCTATCCCACGA Chr9:41795563..41795582 60.45 50
downstream ENSMUSE00000454031 Chr9:41793641..41793723 CCATGGTCAGGGTAAAGCTC Chr9:41793633..41793652 59.55 55
downstream ENSMUSE00000454026 Chr9:41792519..41792618 GTTCACCACGTAGCCATTGA Chr9:41792576..41792595 59.57 50
downstream ENSMUSE00000454020 Chr9:41790989..41791173 CTAGGAGCTGGTGGACTGCT Chr9:41791031..41791050 59.62 60
downstream ENSMUSE00000454015 Chr9:41788709..41788828 TCATCCTTGCTGACGATGAC Chr9:41788703..41788722 59.79 50
downstream ENSMUSE00000454011 Chr9:41787413..41787577 GCGATTCCCATTTGATGAGT Chr9:41787417..41787436 59.9 45
downstream ENSMUSE00000454006 Chr9:41785519..41785693 GTTGCGGGATCTGACTTTGT Chr9:41785603..41785622 60.12 50
downstream ENSMUSE00000454002 Chr9:41784441..41784547 AACGTGGTCGTTTTCCGTTA Chr9:41784473..41784492 60.4 45
downstream ENSMUSE00000453999 Chr9:41782020..41782212 CGAGGTAAGCGGTGAGATTC Chr9:41782139..41782158 59.84 55
downstream ENSMUSE00000453995 Chr9:41777727..41777939 CGGTGCTTCGTGTAGAGGAT Chr9:41777794..41777813 60.28 55
downstream ENSMUSE00000637669 Chr9:41776572..41776753 TGGGGACATCGTCTGAGAAT Chr9:41776678..41776697 60.47 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAGATAATCGCCTTGCAGCAC Chr9:41832893..41832914 60.38 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACAAGGGAAAGAATGCTGGTAA Chr9:41832956..41832978 60 40.91 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000049313