Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11260
Trapped Gene
Mto1 (ENSMUSG00000032342)
Vector Insertion
Chr 9: 78300861 - 78305016
Public Clones G080G04 (ggtc) IST12340H6 (tigm) IST10729C8 (tigm) IST12042H11 (tigm)
IST11128F6 (tigm) IST10842A8 (tigm) IST12353H5 (tigm) IST12602E6HMF1 (tigm)
IST10311G11 (tigm) IST12353H5 (tigm) IST12043A11 (tigm) IST12028E9 (tigm)
IST11908A8 (tigm) IST10746C6 (tigm)
Private Clones OST444607 (lexicon)
Severity of mutation (?) Insertion after 41% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000269893 (Chr9:78300571..78300860 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCCATAGGGTTGGCTCAGAC Chr9:78300687..78300706 60.07 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000269893 (Chr9:78300571..78300860 +)
Downstram Exon
ENSMUSE00000218895 (Chr9:78305017..78305129 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCCATAGGGTTGGCTCAGAC Chr9:78300687..78300706 60.07 55 AAGGACAATCGCATCCACTC Chr9:78305082..78305101 60.08 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000218877 Chr9:78296027..78296317 CTGGCTTCTACTCCGGTGAC Chr9:78296051..78296070 59.87 60
upstream ENSMUSE00000218893 Chr9:78297226..78297425 GCACAGATTGACCGGAAACT Chr9:78297387..78297406 60.12 50
upstream ENSMUSE00000353823 Chr9:78297525..78297642 GGGTCAGAGGTGTTGTCCTG Chr9:78297622..78297641 60.56 60
upstream ENSMUSE00000269893 Chr9:78300571..78300860 TCCATAGGGTTGGCTCAGAC Chr9:78300687..78300706 60.07 55

*** Putative Vector Insertion (Chr 9: 78300861 - 78305016) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000218895 Chr9:78305017..78305129 AAGGACAATCGCATCCACTC Chr9:78305082..78305101 60.08 50
downstream ENSMUSE00000269839 Chr9:78305223..78305413 CTGATGCAGACGATTTGGAA Chr9:78305280..78305299 59.8 45
downstream ENSMUSE00000269816 Chr9:78305724..78305854 CTGATCTGACGGGGGTCTAA Chr9:78305769..78305788 60.06 55
downstream ENSMUSE00000218875 Chr9:78308640..78308844 GTGGCTTTCGACTGACTCGT Chr9:78308691..78308710 60.45 55
downstream ENSMUSE00000218882 Chr9:78309327..78309498 TCAAATCGCTGTGAGGACAC Chr9:78309369..78309388 59.84 50
downstream ENSMUSE00000269774 Chr9:78312691..78312809 GAGCGACTCCATGTCCACTT Chr9:78312739..78312758 60.27 55
downstream ENSMUSE00000269759 Chr9:78318438..78318598 CTGTGGGCGACTCAAGTGTA Chr9:78318598..78318617 59.9 55
downstream ENSMUSE00000218867 Chr9:78321597..78321957 GAGACTCCCACAGGGATTGA Chr9:78321895..78321914 60.05 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGACAGCGTGTGGATCAAG Chr9:78300842..78300862 60.32 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGACAGCGTGTGGATCAAG Chr9:78300842..78300862 60.32 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032342