Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1127
Trapped Gene
Agpat4 (ENSMUSG00000023827)
Vector Insertion
Chr 17: 12312282 - 12344557
Public Clones AP0598 (sanger) CC0173 (sanger) IST14470B2 (tigm)
Private Clones OST455770 (lexicon) OST291509 (lexicon) OST170537 (lexicon) OST92644 (lexicon)
OST42767 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000336429 (Chr17:12312150..12312281 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTGTGAGCACCAATGCAAAG Chr17:12312246..12312265 60.84 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000336429 (Chr17:12312150..12312281 +)
Downstram Exon
ENSMUSE00000377093 (Chr17:12344558..12344815 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTGTGAGCACCAATGCAAAG Chr17:12312246..12312265 60.84 45 GCGATGAACACGTAGCAGAA Chr17:12344708..12344727 60.02 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000336429 Chr17:12312150..12312281 TTGTGAGCACCAATGCAAAG Chr17:12312246..12312265 60.84 45

*** Putative Vector Insertion (Chr 17: 12312282 - 12344557) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000377093 Chr17:12344558..12344815 GCGATGAACACGTAGCAGAA Chr17:12344708..12344727 60.02 50
downstream ENSMUSE00000371130 Chr17:12391618..12391787 CTTGTGATTGAGGACCACGA Chr17:12391733..12391752 59.68 50
downstream ENSMUSE00000135585 Chr17:12403077..12403238 TCCACGAAGTACCACATCCA Chr17:12403150..12403169 59.96 50
downstream ENSMUSE00000135584 Chr17:12403505..12403658 CAACATCTCGCAAGCACTTC Chr17:12403661..12403680 59.6 50
downstream ENSMUSE00000135586 Chr17:12406321..12406423 AGCAGTGTTGGGTTTTCATTG Chr17:12406380..12406400 60.02 42.86
downstream ENSMUSE00000556040 Chr17:12408142..12408217 TGTGTAACCAGGCAGAGCAC Chr17:12408203..12408222 59.9 55
downstream ENSMUSE00000135582 Chr17:12409560..12409758 CCAGAACAACCAGTTGACCA Chr17:12409661..12409680 59.56 50
downstream ENSMUSE00000389483 Chr17:12411851..12412506 CAGTCCGTTTGTTTCCGTTT Chr17:12411947..12411966 60.01 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGTAGCACACGGCTAATCG Chr17:12327319..12327339 60.29 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCTCGTGACTGGGAAAACC Chr17:12327329..12327349 60.09 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023827