Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11283
Trapped Gene
Mto1 (ENSMUSG00000032342)
Vector Insertion
Chr 9: 78305414 - 78305723
Public Clones G074E08 (ggtc) G019A03 (ggtc)
Private Clones OST254946 (lexicon)
Severity of mutation (?) Insertion after 56% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000269839 (Chr9:78305223..78305413 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCCGCAAGGGTTATCTGTTA Chr9:78305319..78305338 59.95 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000269839 (Chr9:78305223..78305413 +)
Downstram Exon
ENSMUSE00000269816 (Chr9:78305724..78305854 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCCGCAAGGGTTATCTGTTA Chr9:78305319..78305338 59.95 50 CTGATCTGACGGGGGTCTAA Chr9:78305769..78305788 60.06 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000218877 Chr9:78296027..78296317 CTGGCTTCTACTCCGGTGAC Chr9:78296051..78296070 59.87 60
upstream ENSMUSE00000218893 Chr9:78297226..78297425 GCACAGATTGACCGGAAACT Chr9:78297387..78297406 60.12 50
upstream ENSMUSE00000353823 Chr9:78297525..78297642 GGGTCAGAGGTGTTGTCCTG Chr9:78297622..78297641 60.56 60
upstream ENSMUSE00000269893 Chr9:78300571..78300860 TCCATAGGGTTGGCTCAGAC Chr9:78300687..78300706 60.07 55
upstream ENSMUSE00000218895 Chr9:78305017..78305129 GAGTGGATGCGATTGTCCTT Chr9:78305060..78305079 60.08 50
upstream ENSMUSE00000269839 Chr9:78305223..78305413 CCCGCAAGGGTTATCTGTTA Chr9:78305319..78305338 59.95 50

*** Putative Vector Insertion (Chr 9: 78305414 - 78305723) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000269816 Chr9:78305724..78305854 CTGATCTGACGGGGGTCTAA Chr9:78305769..78305788 60.06 55
downstream ENSMUSE00000218875 Chr9:78308640..78308844 GTGGCTTTCGACTGACTCGT Chr9:78308691..78308710 60.45 55
downstream ENSMUSE00000218882 Chr9:78309327..78309498 TCAAATCGCTGTGAGGACAC Chr9:78309369..78309388 59.84 50
downstream ENSMUSE00000269774 Chr9:78312691..78312809 GAGCGACTCCATGTCCACTT Chr9:78312739..78312758 60.27 55
downstream ENSMUSE00000269759 Chr9:78318438..78318598 CTGTGGGCGACTCAAGTGTA Chr9:78318598..78318617 59.9 55
downstream ENSMUSE00000218867 Chr9:78321597..78321957 GAGACTCCCACAGGGATTGA Chr9:78321895..78321914 60.05 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCATCAGAGGCTTGGAGAAA Chr9:78305376..78305396 60.48 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTAGCGTGACTGGGAAAACC Chr9:78305461..78305481 60.11 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032342