Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11290
Trapped Gene
Cd63 (ENSMUSG00000025351)
Vector Insertion
Chr 10: 128347015 - 128347450
Public Clones G072A05 (ggtc) CMHD-GT_487H11-3 (cmhd) CMHD-GT_340D1-3 (cmhd) CMHD-GT_465F5-3 (cmhd)
CMHD-GT_336G3-3 (cmhd)
Private Clones OST442165 (lexicon) OST442154 (lexicon) OST398349 (lexicon) OST397750 (lexicon)
OST279476 (lexicon) OST275123 (lexicon) OST274444 (lexicon) OST264146 (lexicon)
OST264091 (lexicon) OST261885 (lexicon) OST33319 (lexicon) OST32451 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000639378 (Chr10:128346922..128347014 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCGGCAGGAGAGTACTGAGA Chr10:128346978..128346997 60.7 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000639378 (Chr10:128346922..128347014 +)
Downstram Exon
ENSMUSE00000150024 (Chr10:128347451..128347527 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCGGCAGGAGAGTACTGAGA Chr10:128346978..128346997 60.7 60 CCAGCAGGAGAACGTAGAGC Chr10:128347522..128347541 60.16 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000665397 Chr10:128345975..128346108 CTGCGGAGAAAAGGACAAAG Chr10:128346000..128346019 59.99 50
upstream ENSMUSE00000639378 Chr10:128346922..128347014 GCGGCAGGAGAGTACTGAGA Chr10:128346978..128346997 60.7 60

*** Putative Vector Insertion (Chr 10: 128347015 - 128347450) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000150024 Chr10:128347451..128347527 CCAGCAGGAGAACGTAGAGC Chr10:128347522..128347541 60.16 60
downstream ENSMUSE00000150030 Chr10:128348508..128348696 ACAACCTGAACCGCTACACC Chr10:128348557..128348576 60.03 55
downstream ENSMUSE00000150028 Chr10:128348851..128348925 CCACCTCCACAAGCATGATA Chr10:128348893..128348912 59.52 50
downstream ENSMUSE00000150027 Chr10:128349024..128349119 ATCTGCTGCTGGAAGCTTTT Chr10:128349064..128349083 59.22 45
downstream ENSMUSE00000150025 Chr10:128349217..128349357 CAAGAATCGGGGACTCTGTC Chr10:128349299..128349318 59.65 55
downstream ENSMUSE00000150031 Chr10:128349494..128349577 CAGCCACCAGCAGTATGTTC Chr10:128349551..128349570 59.32 55
downstream ENSMUSE00000150026 Chr10:128349731..128349872 CCCCCACCCCTACATTACTT Chr10:128349808..128349827 59.93 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCGGCAGGAGAGTACTGAGA Chr10:128346979..128346999 60.7 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCGGCAGGAGAGTACTGAGA Chr10:128346979..128346999 60.7 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025351