Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11300
Trapped Gene
Fn1 (ENSMUSG00000026193)
Vector Insertion
Chr 1: 71678737 - 71683825
Public Clones G069A06 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 26% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000629702 (Chr1:71683826..71683969 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GACCCGGACATTTTACCAGA Chr1:71683931..71683950 59.79 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000629702 (Chr1:71683826..71683969 -)
Downstram Exon
ENSMUSE00000629701 (Chr1:71678615..71678736 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GACCCGGACATTTTACCAGA Chr1:71683931..71683950 59.79 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000544656 Chr1:71699406..71699746 CTCCTCCCATCCACTCAAGA Chr1:71699556..71699575 60.19 55
upstream ENSMUSE00000629712 Chr1:71698095..71698223 GGGTTTTAACTGCGAGAGCA Chr1:71698104..71698123 60.39 50
upstream ENSMUSE00000629711 Chr1:71697136..71697273 ATGAGCGCCCTAAAGATTCC Chr1:71697197..71697216 60.55 50
upstream ENSMUSE00000629710 Chr1:71695768..71695899 AAGATTGGCGACAAGTGGAG Chr1:71695851..71695870 60.26 50
upstream ENSMUSE00000629709 Chr1:71694583..71694720 CAATGGACGCATCACCTGTA Chr1:71694592..71694611 60.54 50
upstream ENSMUSE00000629708 Chr1:71692121..71692276 AAGGACAACCGAGGAAACCT Chr1:71692198..71692217 59.97 50
upstream ENSMUSE00000629707 Chr1:71689534..71689725 GAAGTCGCAAGGAAACAAGC Chr1:71689582..71689601 60 50
upstream ENSMUSE00000629706 Chr1:71688526..71688705 TCCTCCCGTTCACCTACAAC Chr1:71688641..71688660 59.97 55
upstream ENSMUSE00000629705 Chr1:71687726..71687902 AACCGGAATTACACCGACTG Chr1:71687818..71687837 59.85 50
upstream ENSMUSE00000629704 Chr1:71686866..71687018 GTATCGCATTGGGGATCAGT Chr1:71686962..71686981 59.78 50
upstream ENSMUSE00000629703 Chr1:71685031..71685159 ACGAGGAGGGACATATGCTG Chr1:71685083..71685102 60.1 55
upstream ENSMUSE00000629702 Chr1:71683826..71683969 GACCCGGACATTTTACCAGA Chr1:71683931..71683950 59.79 50

*** Putative Vector Insertion (Chr 1: 71678737 - 71683825) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000629701 Chr1:71678615..71678736 No primer for this exon
downstream ENSMUSE00000629700 Chr1:71676240..71676417 CGAAGCGTGTCACTTCTCTG Chr1:71676251..71676270 59.77 55
downstream ENSMUSE00000629699 Chr1:71675890..71676066 CCTCCTCGCTCAGCTCATAC Chr1:71675889..71675908 60.12 60
downstream ENSMUSE00000629698 Chr1:71674982..71675110 CAGGAATGTTCACGGAAGTG Chr1:71675053..71675072 59.13 50
downstream ENSMUSE00000629697 Chr1:71674631..71674720 GGGTCTACTCCACCGAACAA Chr1:71674625..71674644 59.97 55
downstream ENSMUSE00000629696 Chr1:71673737..71673931 GATGAAAACGGGTGTGCTCT Chr1:71673746..71673765 60.12 50
downstream ENSMUSE00000629695 Chr1:71672548..71672820 ACCTCCACACGGTATCCAGA Chr1:71672690..71672709 60.39 55
downstream ENSMUSE00000629694 Chr1:71670652..71670918 AGGGTCCCACATTGTACTGC Chr1:71670744..71670763 59.85 55
downstream ENSMUSE00000629693 Chr1:71667299..71667393 CCTCGGTGTTGTAAGGTGGA Chr1:71667333..71667352 60.94 55
downstream ENSMUSE00000629692 Chr1:71665958..71666126 TCTGTTGACAATCGGTGCAT Chr1:71665946..71665965 60.12 45
downstream ENSMUSE00000629691 Chr1:71665153..71665239 AAGTTGGTCGGTGGAGACAG Chr1:71665196..71665215 60.15 55
downstream ENSMUSE00000629690 Chr1:71661934..71662125 TGATCAGCATGGACCACTTC Chr1:71662022..71662041 59.64 50
downstream ENSMUSE00000544622 Chr1:71660337..71660609 TGCCGCAACTACTGTGATTC Chr1:71660469..71660488 59.87 50
downstream ENSMUSE00000629689 Chr1:71659042..71659224 GGACCGATATTGGTGAATCG Chr1:71659160..71659179 60.15 50
downstream ENSMUSE00000629688 Chr1:71657503..71657592 GGATGCTCTCATGTTGTTCG Chr1:71657505..71657524 59.24 50
downstream ENSMUSE00000629687 Chr1:71655987..71656256 TGAATGAGTTGGCGGTGATA Chr1:71656181..71656200 60.07 45
downstream ENSMUSE00000629686 Chr1:71654478..71654594 GACCTCCAGATCTCTCGGAAT Chr1:71654544..71654564 59.65 52.38
downstream ENSMUSE00000629685 Chr1:71653277..71653441 ATTGATGGAAACTGGCTTGC Chr1:71653265..71653284 60.08 45
downstream ENSMUSE00000629684 Chr1:71652459..71652614 GGGAGTGGTGGTCACTCTGT Chr1:71652480..71652499 60.01 60
downstream ENSMUSE00000544614 Chr1:71651544..71651657 TTGCAAACCTTCAATGGTCA Chr1:71651604..71651623 60.09 40
downstream ENSMUSE00000377635 Chr1:71650234..71650503 TCTGCAGTGTCGTCTTCACC Chr1:71650310..71650329 60.03 55
downstream ENSMUSE00000629683 Chr1:71648884..71649071 GCAGTAAAGCTGGTGGGTGT Chr1:71648992..71649011 60.18 55
downstream ENSMUSE00000629682 Chr1:71647775..71647862 GCTGGTCTGCTTGTCAGTGT Chr1:71647779..71647798 59.05 55
downstream ENSMUSE00000629681 Chr1:71646864..71647040 CTCCTCTGAACTGGGGTCTG Chr1:71646877..71646896 59.83 60
downstream ENSMUSE00000629680 Chr1:71646177..71646266 TGTAGTCAGTGCCTGGCTGT Chr1:71646221..71646240 59.49 55
downstream ENSMUSE00000629679 Chr1:71645789..71645968 CCATGACACCAGCAAGGAGT Chr1:71645882..71645901 61.13 55
downstream ENSMUSE00000629678 Chr1:71644948..71645037 TCAGGGCAATGACGTAGATG Chr1:71644971..71644990 59.67 50
downstream ENSMUSE00000629671 Chr1:71643855..71644246 CAACTGGTTGGCATGAAATG Chr1:71643856..71643875 59.96 45
downstream ENSMUSE00000629677 Chr1:71643855..71644321 ATTCGGCAGGTATGGTCTTG Chr1:71644037..71644056 59.96 50
downstream ENSMUSE00000629676 Chr1:71642238..71642376 AACCTCTTCCCGAACCTTGT Chr1:71642235..71642254 59.97 50
downstream ENSMUSE00000629675 Chr1:71639645..71639809 CCGTGTAAGGGTCAAAGCAT Chr1:71639734..71639753 59.99 50
downstream ENSMUSE00000629674 Chr1:71637341..71637466 CCCACTTCTCTCCGATCTTG Chr1:71637397..71637416 59.8 55
downstream ENSMUSE00000629673 Chr1:71636672..71636778 TCGTCATAGCACGTTGCTTC Chr1:71636735..71636754 60.02 50
downstream ENSMUSE00000629672 Chr1:71633404..71633517 CAGGTCTACGGCAGTTGTCA Chr1:71633465..71633484 59.9 55
downstream ENSMUSE00000544580 Chr1:71632094..71632857 ATCTAGCGGCATGAAGCACT Chr1:71632797..71632816 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAACCTCTGCAGACCTACCC Chr1:71683826..71683846 59.72 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAACCTCTGCAGACCTACCC Chr1:71683826..71683846 59.72 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026193