Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11332
Trapped Gene
Eif4g2 (ENSMUSG00000005610)
Vector Insertion
Chr 7: 118223837 - 118224412
Public Clones (ggtc) M025F05 (ggtc) (ggtc) P019D02 (ggtc)
Private Clones OST314910 (lexicon) OST289210 (lexicon)
Severity of mutation (?) Insertion after 4% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000203239 (Chr7:118224413..118224478 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000203239 (Chr7:118224413..118224478 -)
Downstram Exon
ENSMUSE00000203247 (Chr7:118223696..118223836 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000394849 Chr7:118226299..118226508 No primer for this exon
upstream ENSMUSE00000354145 Chr7:118225021..118225147 No primer for this exon
upstream ENSMUSE00000203239 Chr7:118224413..118224478 No primer for this exon

*** Putative Vector Insertion (Chr 7: 118223837 - 118224412) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000203247 Chr7:118223696..118223836 No primer for this exon
downstream ENSMUSE00000203241 Chr7:118222807..118222909 No primer for this exon
downstream ENSMUSE00000203240 Chr7:118221936..118222067 No primer for this exon
downstream ENSMUSE00000203220 Chr7:118221787..118221853 No primer for this exon
downstream ENSMUSE00000203236 Chr7:118221539..118221690 No primer for this exon
downstream ENSMUSE00000203235 Chr7:118221151..118221261 No primer for this exon
downstream ENSMUSE00000203238 Chr7:118220923..118221006 No primer for this exon
downstream ENSMUSE00000203261 Chr7:118220739..118220837 No primer for this exon
downstream ENSMUSE00000203216 Chr7:118220452..118220590 No primer for this exon
downstream ENSMUSE00000203258 Chr7:118220210..118220370 No primer for this exon
downstream ENSMUSE00000203223 Chr7:118219794..118219907 No primer for this exon
downstream ENSMUSE00000203229 Chr7:118219101..118219226 No primer for this exon
downstream ENSMUSE00000203237 Chr7:118218851..118218955 No primer for this exon
downstream ENSMUSE00000203232 Chr7:118218540..118218755 No primer for this exon
downstream ENSMUSE00000203243 Chr7:118218194..118218452 No primer for this exon
downstream ENSMUSE00000203225 Chr7:118217854..118218058 No primer for this exon
downstream ENSMUSE00000203250 Chr7:118217552..118217763 No primer for this exon
downstream ENSMUSE00000203253 Chr7:118217343..118217464 No primer for this exon
downstream ENSMUSE00000391324 Chr7:118215447..118216271 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr7:118224342..118224362 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGTGCACCTCAGCACTATC Chr7:118224430..118224450 60.69 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GGGTGCACCTCAGCACTATC Chr7:118224430..118224450 60.69 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CTCAGCACTATCCCCGTGAC Chr7:118224422..118224442 60.68 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000005610