Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11339
Trapped Gene
Ncstn (ENSMUSG00000003458)
Vector Insertion
Chr 1: 174001701 - 174002251
Public Clones F038A03 (ggtc) F035F08 (ggtc) F035F04 (ggtc) F052C05 (ggtc) P080H12 (ggtc)
F038A01 (ggtc) F013E02 (ggtc) F038A07 (ggtc) F038A08 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 47% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000160457 (Chr1:174002252..174002404 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000160457 (Chr1:174002252..174002404 -)
Downstram Exon
ENSMUSE00000160452 (Chr1:174001596..174001700 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000378092 Chr1:174012732..174012845 No primer for this exon
upstream ENSMUSE00000160455 Chr1:174011343..174011447 No primer for this exon
upstream ENSMUSE00000160445 Chr1:174005536..174005659 No primer for this exon
upstream ENSMUSE00000160453 Chr1:174005046..174005167 No primer for this exon
upstream ENSMUSE00000160454 Chr1:174004404..174004549 No primer for this exon
upstream ENSMUSE00000160446 Chr1:174002908..174003058 No primer for this exon
upstream ENSMUSE00000160444 Chr1:174002597..174002706 No primer for this exon
upstream ENSMUSE00000160457 Chr1:174002252..174002404 No primer for this exon

*** Putative Vector Insertion (Chr 1: 174001701 - 174002251) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000160452 Chr1:174001596..174001700 No primer for this exon
downstream ENSMUSE00000160456 Chr1:174001382..174001459 No primer for this exon
downstream ENSMUSE00000160443 Chr1:174000107..174000279 No primer for this exon
downstream ENSMUSE00000160451 Chr1:173998893..173998995 No primer for this exon
downstream ENSMUSE00000160450 Chr1:173998693..173998788 No primer for this exon
downstream ENSMUSE00000160442 Chr1:173998317..173998404 No primer for this exon
downstream ENSMUSE00000160448 Chr1:173997920..173998074 No primer for this exon
downstream ENSMUSE00000160447 Chr1:173997462..173997674 No primer for this exon
downstream ENSMUSE00000384073 Chr1:173996805..173996927 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTCTTCTTCCAGGGGGTAA Chr1:174002246..174002266 59.52 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTCTTCTTCCAGGGGGTAA Chr1:174002246..174002266 59.52 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000003458