Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11340
Trapped Gene
Gdi2 (ENSMUSG00000021218)
Vector Insertion
Chr 13: 3553793 - 3555559
Public Clones A054C07 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 23% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000115702 (Chr13:3553658..3553792 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000115702 (Chr13:3553658..3553792 +)
Downstram Exon
ENSMUSE00000115705 (Chr13:3555560..3555758 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000354843 Chr13:3537395..3537589 No primer for this exon
upstream ENSMUSE00000115695 Chr13:3548109..3548216 No primer for this exon
upstream ENSMUSE00000418244 Chr13:3550235..3550334 No primer for this exon
upstream ENSMUSE00000115702 Chr13:3553658..3553792 No primer for this exon

*** Putative Vector Insertion (Chr 13: 3553793 - 3555559) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000115705 Chr13:3555560..3555758 No primer for this exon
downstream ENSMUSE00000115701 Chr13:3556172..3556303 No primer for this exon
downstream ENSMUSE00000256278 Chr13:3559238..3559337 No primer for this exon
downstream ENSMUSE00000256271 Chr13:3561112..3561283 No primer for this exon
downstream ENSMUSE00000572199 Chr13:3563786..3563930 No primer for this exon
downstream ENSMUSE00000256258 Chr13:3564105..3564159 No primer for this exon
downstream ENSMUSE00000482184 Chr13:3564242..3565066 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTTCCTTCCACTGAAGCAG Chr13:3553759..3553779 59.84 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTTCCTTCCACTGAAGCAG Chr13:3553759..3553779 59.84 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021218