Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11370
Trapped Gene
Igsf3 (ENSMUSG00000042035)
Vector Insertion
Chr 3: 101182416 - 101229373
Public Clones G020A12 (ggtc) FHCRC-GT-S18-5D1 (fhcrc) IST10571C9 (tigm) IST14676E2 (tigm)
IST10704F2 (tigm) IST12343C9 (tigm) IST12492E4 (tigm) IST12363C11 (tigm)
IST13882E12 (tigm) IST12956E9 (tigm) IST12344E7 (tigm) IST14899D3 (tigm)
IST13117H3 (tigm) IST10946H5 (tigm) IST10035A7 (tigm) IST14022H10 (tigm)
IST14053H10 (tigm) IST14906B6 (tigm) IST14253H1 (tigm) IST15085D12 (tigm)
IST12956E9 (tigm) IST14494B5 (tigm) IST14644D9 (tigm) IST11001B4 (tigm)
IST11113E7 (tigm)
Private Clones OST472659 (lexicon) OST46970 (lexicon) OST29583 (lexicon)
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000456978 (Chr3:101181729..101182415 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGAATGAGCGATCTCAGACA Chr3:101181944..101181963 60.1 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000456978 (Chr3:101181729..101182415 +)
Downstram Exon
ENSMUSE00000456959 (Chr3:101229374..101229751 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGAATGAGCGATCTCAGACA Chr3:101181944..101181963 60.1 50 CTCCCAAAGTAGCGCTCATC Chr3:101229728..101229747 59.98 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000503310 Chr3:101181048..101181125 No primer for this exon
upstream ENSMUSE00000456978 Chr3:101181729..101182415 CGAATGAGCGATCTCAGACA Chr3:101181944..101181963 60.1 50

*** Putative Vector Insertion (Chr 3: 101182416 - 101229373) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000456959 Chr3:101229374..101229751 CTCCCAAAGTAGCGCTCATC Chr3:101229728..101229747 59.98 55
downstream ENSMUSE00000456951 Chr3:101230953..101231363 GGTGAGACGAAAGGTGCTTC Chr3:101231230..101231249 59.85 55
downstream ENSMUSE00000456946 Chr3:101235127..101235516 AGACGCACGGTGAACTCTTT Chr3:101235151..101235170 59.91 50
downstream ENSMUSE00000244853 Chr3:101239254..101239655 CTCTCCCTCAAGGACGACAC Chr3:101239312..101239331 59.83 60
downstream ENSMUSE00000456935 Chr3:101243298..101243702 CCTCCATCTCGTGTGAAGGT Chr3:101243484..101243503 60.11 55
downstream ENSMUSE00000370610 Chr3:101254807..101255217 CGTAGGTCCCGTACTCGAAG Chr3:101255013..101255032 59.75 60
downstream ENSMUSE00000456923 Chr3:101259028..101259435 GTCCTGTACCGCCACATTCT Chr3:101259326..101259345 60 55
downstream ENSMUSE00000456919 Chr3:101261546..101262031 TAGGGAATACCAGGCCACAG Chr3:101261679..101261698 59.95 55
downstream ENSMUSE00000515848 Chr3:101263710..101264773 TCCGGCTGAAGGAAGAGATA Chr3:101264614..101264633 59.91 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCTGTGCTGGGTAAGTGAC Chr3:101215406..101215426 60.72 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGTTGCCAAATTCCCTCAC Chr3:101215431..101215451 59.8 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042035