Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11379
Trapped Gene
Edem2 (ENSMUSG00000038312)
Vector Insertion
Chr 2: 155544126 - 155548167
Public Clones G009D11 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 21% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000323815 (Chr2:155548168..155548273 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATATCGACGTGAACGCCTCT Chr2:155548190..155548209 59.72 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000323815 (Chr2:155548168..155548273 -)
Downstram Exon
ENSMUSE00000323807 (Chr2:155544000..155544125 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATATCGACGTGAACGCCTCT Chr2:155548190..155548209 59.72 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000323838 Chr2:155554967..155555146 TATGCCTTTCCGGCTACTCA Chr2:155555055..155555074 60.73 50
upstream ENSMUSE00000323833 Chr2:155554627..155554737 CCCTACGATGAGCTGAGACC Chr2:155554660..155554679 59.83 60
upstream ENSMUSE00000323823 Chr2:155552371..155552410 No primer for this exon
upstream ENSMUSE00000323815 Chr2:155548168..155548273 ATATCGACGTGAACGCCTCT Chr2:155548190..155548209 59.72 50

*** Putative Vector Insertion (Chr 2: 155544126 - 155548167) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000323807 Chr2:155544000..155544125 No primer for this exon
downstream ENSMUSE00000323796 Chr2:155541746..155541957 TGCTCAGGGTAGCAAATTCC Chr2:155541807..155541826 60.21 50
downstream ENSMUSE00000323788 Chr2:155539074..155539215 CACTTGCCAGTGAGCACATC Chr2:155539159..155539178 60.47 55
downstream ENSMUSE00000323781 Chr2:155536580..155536704 CACGGTCCCCTTGTACATCT Chr2:155536606..155536625 59.84 55
downstream ENSMUSE00000323774 Chr2:155534668..155534812 CCTTCTCGCTTCTCCACTGT Chr2:155534663..155534682 59.6 55
downstream ENSMUSE00000323765 Chr2:155531391..155531512 AATGGATTCCACAGCGTCTC Chr2:155531405..155531424 60.08 50
downstream ENSMUSE00000388654 Chr2:155527761..155528328 AAAGACTCCATGCGGTTGTC Chr2:155528260..155528279 60.12 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTGTTCGAAACCAACATCC Chr2:155548169..155548189 59.39 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATATCGACGTGAACGCCTCT Chr2:155545188..155545208 59.72 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038312