Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11393
Trapped Gene
B3gnt2 (ENSMUSG00000051650)
Vector Insertion
Chr 11: 22759704 - 22760217
Public Clones Q012C05 (ggtc) W168C07 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000331247 (Chr11:22760218..22760336 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AACCTGAAGGTCCGAAGAGG Chr11:22760292..22760311 60.62 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000331247 (Chr11:22760218..22760336 -)
Downstram Exon
ENSMUSE00000370857 (Chr11:22759494..22759703 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AACCTGAAGGTCCGAAGAGG Chr11:22760292..22760311 60.62 55 TCTAGGGACACCTCCAGCTC Chr11:22759476..22759495 59.4 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000331247 Chr11:22760218..22760336 AACCTGAAGGTCCGAAGAGG Chr11:22760292..22760311 60.62 55

*** Putative Vector Insertion (Chr 11: 22759704 - 22760217) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000370857 Chr11:22759494..22759703 TCTAGGGACACCTCCAGCTC Chr11:22759476..22759495 59.4 60
downstream ENSMUSE00000357467 Chr11:22734865..22737195 GCCCAGCAACTTGACTCTTC Chr11:22737129..22737148 60 55
downstream ENSMUSE00000493466 Chr11:22734857..22737195 GCCCAGCAACTTGACTCTTC Chr11:22737129..22737148 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGTTTCCCTCTTCTCACCT Chr11:22760183..22760203 59.53 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGTTTCCCTCTTCTCACCT Chr11:22760183..22760203 59.53 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000051650