Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1141
Trapped Gene
Nfya (ENSMUSG00000023994)
Vector Insertion
Chr 17: 48528668 - 48530573
Public Clones CC0050 (sanger) PST25114-NR (escells)
Private Clones not available
Severity of mutation (?) Insertion after 95% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000137021 (Chr17:48530574..48530675 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCGCTTCTTCTCTCCAAAAG Chr17:48530597..48530616 59.19 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000137021 (Chr17:48530574..48530675 -)
Downstram Exon
ENSMUSE00000353117 (Chr17:48526232..48528667 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCGCTTCTTCTCTCCAAAAG Chr17:48530597..48530616 59.19 50 AAGGCAGCCAACTCTTTTGA Chr17:48527126..48527145 59.99 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000461831 Chr17:48548951..48549090 GTTCAGATTCGCCATTTTGC Chr17:48549060..48549079 60.59 45
upstream ENSMUSE00000315814 Chr17:48539763..48539905 No primer for this exon
upstream ENSMUSE00000315649 Chr17:48538307..48538393 No primer for this exon
upstream ENSMUSE00000137023 Chr17:48534975..48535121 AGCCGTTAATGGTGCAAGTC Chr17:48535092..48535111 60.14 50
upstream ENSMUSE00000137024 Chr17:48532746..48532877 TCAAACCCAGCAGATCATCA Chr17:48532787..48532806 60.2 45
upstream ENSMUSE00000137020 Chr17:48532505..48532610 CCCAGACTGCTGAAGGACAG Chr17:48532554..48532573 61 60
upstream ENSMUSE00000137022 Chr17:48531665..48531831 CAACACAACCAGCAGTGGAC Chr17:48531730..48531749 60.2 55
upstream ENSMUSE00000137019 Chr17:48531201..48531374 AAGGGAAAATCCCAAAGGAA Chr17:48531207..48531226 59.75 40
upstream ENSMUSE00000137021 Chr17:48530574..48530675 CCGCTTCTTCTCTCCAAAAG Chr17:48530597..48530616 59.19 50

*** Putative Vector Insertion (Chr 17: 48528668 - 48530573) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000353117 Chr17:48526232..48528667 AAGGCAGCCAACTCTTTTGA Chr17:48527126..48527145 59.99 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATCACGTGACTGGGAAAACC Chr17:48530506..48530526 59.83 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 2 GCTGTAGAGCGTGGTTCTCC Chr17:48530694..48530714 60.02 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 3 TGCTGTAGAGCGTGGTTCTC Chr17:48527695..48527715 59.19 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023994