Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11412
Trapped Gene
Wwp2 (ENSMUSG00000031930)
Vector Insertion
Chr 8: 109960342 - 109976878
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) (sanger) M122D07 (ggtc)
D143G04 (ggtc) D050G07 (ggtc) (ggtc) (ggtc) M125F11 (ggtc) D127E06 (ggtc)
(ggtc) (ggtc) D143H06 (ggtc) D054B02 (ggtc) (ggtc) (ggtc)
M125F11 (ggtc) D136B04 (ggtc) D050F07 (ggtc) 5SE286A03 (ggtc) (ggtc)
E069G04 (ggtc) D127E06 (ggtc) (ggtc) (ggtc) M123A07 (ggtc) D143H06 (ggtc)
D050G07 (ggtc) (ggtc) (ggtc) D136B04 (ggtc) D050F07 (ggtc) 3SE286A03 (ggtc)
(ggtc) D182D08 (ggtc) D117D12 (ggtc) (ggtc) (ggtc) FHCRC-GT-S6-1E1 (fhcrc)
IST10519E10 (tigm) IST14953D6 (tigm) IST12332C10 (tigm) IST10018B5 (tigm)
IST10920A9 (tigm) IST14737D3 (tigm) IST14137A12 (tigm) IST10004C3 (tigm)
IST10004C3 (tigm) IST14918B7 (tigm) IST10073G3 (tigm) IST10524F7BBF1 (tigm)
IST11485H4 (tigm) IST11687D8 (tigm) IST14645G9 (tigm) IST14393H7 (tigm)
IST10698B4 (tigm) IST12496H8 (tigm) IST10282H12 (tigm) IST14938E5 (tigm)
IST12023G1 (tigm) IST14961G8 (tigm) IST14593E4 (tigm) IST13202F1 (tigm)
IST12112F6 (tigm) IST14595G12 (tigm) IST14116A8 (tigm) IST10305E3 (tigm)
IST14070H7 (tigm) IST13181B6 (tigm) IST14643B5 (tigm) IST14421H4 (tigm)
IST13202F4 (tigm) IST11704H9 (tigm) IST14021D7 (tigm) IST11385A3 (tigm)
IST10082C11 (tigm) IST14561H4 (tigm) IST14501G9 (tigm) IST11198B4 (tigm)
IST10206G7 (tigm) IST14635B5 (tigm) IST10922E5 (tigm) IST10118E7BBR1 (tigm)
IST14493H4 (tigm) IST13361A3 (tigm) IST13839H2 (tigm) IST14593C3 (tigm)
IST14573H1 (tigm) IST14070H8 (tigm) IST10982D5 (tigm) IST14537D9 (tigm)
IST14120A8 (tigm) IST13428F11 (tigm) IST10491F4 (tigm) IST14477E11 (tigm)
IST14500A1 (tigm) IST10166D5 (tigm) IST14285A3 (tigm) IST12830A12 (tigm)
IST10458A3 (tigm) IST13213H4 (tigm) IST13252E9 (tigm) IST14566C6 (tigm)
IST10519E10 (tigm) IST10038H3 (tigm) IST10890D10 (tigm) IST15088D10 (tigm)
IST10982E3 (tigm) IST14021D7 (tigm) IST12049G3 (tigm) IST11754D6 (tigm)
IST14156E4 (tigm) IST11989F2 (tigm) IST14575D10 (tigm) IST14857H6 (tigm)
IST14681G3 (tigm) IST13076B11 (tigm) IST14717A5 (tigm) IST14353D5 (tigm)
IST13339G11 (tigm) IST15005A1 (tigm) IST14505H1 (tigm) IST10402G3 (tigm)
IST12023G1 (tigm) IST10083C9 (tigm)
Private Clones OST438026 (lexicon) OST419695 (lexicon) OST374401 (lexicon) OST370920 (lexicon)
OST369460 (lexicon) OST367583 (lexicon) OST364593 (lexicon) OST360828 (lexicon)
OST350951 (lexicon) OST333329 (lexicon) OST321274 (lexicon) OST315570 (lexicon)
OST312084 (lexicon) OST311025 (lexicon) OST307313 (lexicon) OST300263 (lexicon)
OST293260 (lexicon) OST284231 (lexicon) OST280264 (lexicon) OST276968 (lexicon)
OST275680 (lexicon) OST274965 (lexicon) OST261905 (lexicon) OST246267 (lexicon)
OST243837 (lexicon) OST238506 (lexicon) OST237637 (lexicon) OST236754 (lexicon)
OST236574 (lexicon) OST225403 (lexicon) OST216038 (lexicon) OST215609 (lexicon)
OST215077 (lexicon) OST212026 (lexicon) OST211528 (lexicon) OST207995 (lexicon)
OST207821 (lexicon) OST204462 (lexicon) OST204060 (lexicon) OST203738 (lexicon)
OST202134 (lexicon) OST198273 (lexicon) OST189264 (lexicon) OST187045 (lexicon)
OST184848 (lexicon) OST179379 (lexicon) OST170870 (lexicon) OST165850 (lexicon)
OST164833 (lexicon) OST158482 (lexicon) OST151051 (lexicon) OST148296 (lexicon)
OST146085 (lexicon) OST145733 (lexicon) OST134019 (lexicon) OST128324 (lexicon)
OST127411 (lexicon) OST108153 (lexicon) OST104830 (lexicon) OST104567 (lexicon)
OST102560 (lexicon) OST101004 (lexicon) OST98814 (lexicon) OST90801 (lexicon)
OST85061 (lexicon) OST77181 (lexicon) OST73155 (lexicon) OST65766 (lexicon)
OST62216 (lexicon) OST52373 (lexicon) OST45370 (lexicon) OST43587 (lexicon)
OST40259 (lexicon) OST34083 (lexicon) OST33665 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000423226 (Chr8:109960317..109960341 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000423226 (Chr8:109960317..109960341 +)
Downstram Exon
ENSMUSE00000214780 (Chr8:109976879..109976963 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TCAGGGTAAGCTGGGACTTC Chr8:109976963..109976982 59.28 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000423226 Chr8:109960317..109960341 No primer for this exon

*** Putative Vector Insertion (Chr 8: 109960342 - 109976878) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000214780 Chr8:109976879..109976963 TCAGGGTAAGCTGGGACTTC Chr8:109976963..109976982 59.28 55
downstream ENSMUSE00000214760 Chr8:109981343..109981490 CTTCCCCGTCTTCTTGGTCT Chr8:109981449..109981468 60.62 55
downstream ENSMUSE00000214778 Chr8:109981780..109981901 GAGGCAGTGCCCAGTAGTTC Chr8:109981863..109981882 59.87 60
downstream ENSMUSE00000423204 Chr8:110007232..110007369 CTCTCCTCCCGAGACAACAC Chr8:110007302..110007321 59.83 60
downstream ENSMUSE00000423202 Chr8:110009446..110009542 GATCTGCCACCAAAGCAGTT Chr8:110009542..110009561 60.26 50
downstream ENSMUSE00000423195 Chr8:110030207..110030334 CTGAGCCACCTGAGTGTCTG Chr8:110030235..110030254 59.6 60
downstream ENSMUSE00000423186 Chr8:110041801..110042011 GGCAGGGATGTTACACCAAC Chr8:110041870..110041889 60.24 55
downstream ENSMUSE00000423183 Chr8:110057100..110057189 GTGGTGGTCTTGGTGTTGTG Chr8:110057168..110057187 59.89 55
downstream ENSMUSE00000423177 Chr8:110064524..110064698 CTGCCACTGCTCATAGTTGC Chr8:110064641..110064660 59.62 55
downstream ENSMUSE00000423173 Chr8:110069344..110069398 TCAGTCGAAGCACTCGAAGA Chr8:110069366..110069385 59.85 50
downstream ENSMUSE00000423167 Chr8:110072369..110072450 TCCATTGTCCTGCCTCTTCT Chr8:110072391..110072410 59.8 50
downstream ENSMUSE00000423161 Chr8:110072929..110073057 CCCTCGCTGGTGTATTTCAT Chr8:110072988..110073007 59.96 50
downstream ENSMUSE00000423157 Chr8:110073360..110073435 ACTTCGGTCATAGGCACCAG Chr8:110073399..110073418 60.13 55
downstream ENSMUSE00000423152 Chr8:110073681..110073752 TGGAAACGCTGATCTTCACA Chr8:110073723..110073742 60.39 45
downstream ENSMUSE00000423146 Chr8:110073947..110074035 CGCAGGTCGTAAGGTTTCAT Chr8:110073978..110073997 60.13 50
downstream ENSMUSE00000580160 Chr8:110076177..110076336 CTGCCGATAAAGCGGAAGTA Chr8:110076326..110076345 60.36 50
downstream ENSMUSE00000423133 Chr8:110077869..110078002 TGTTGAGCATCCGCTTGTAG Chr8:110077938..110077957 60.01 50
downstream ENSMUSE00000423127 Chr8:110078333..110078473 TCTCCTCGGTAACTCGGATG Chr8:110078457..110078476 60.21 55
downstream ENSMUSE00000423124 Chr8:110078881..110079001 CAACCTCATTGAAGCCATCC Chr8:110078960..110078979 60.46 50
downstream ENSMUSE00000423118 Chr8:110079314..110079418 CTGCCAGTCGCTCATGTCTA Chr8:110079361..110079380 60.16 55
downstream ENSMUSE00000580159 Chr8:110080361..110080457 GTAGCCGGATCCTCTTCTCA Chr8:110080403..110080422 59.39 55
downstream ENSMUSE00000422582 Chr8:110080612..110080684 CCAACTCTGTCGATGCAGAA Chr8:110080654..110080673 59.98 50
downstream ENSMUSE00000423213 Chr8:110080787..110081112 AACCCCTCAGTCTCCTCGAT Chr8:110080876..110080895 60.07 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCCTGTCTCGGACACATAA Chr8:109960347..109960367 60.26 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCCTGTCTCGGACACATAA Chr8:109960347..109960367 60.26 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031930