Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11425
Trapped Gene
Seh1l (ENSMUSG00000079614)
Vector Insertion
Chr 18: 67934529 - 67934775
Public Clones M120A04 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000386284 (Chr18:67934530..67934774 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CATCCACGATGTGTCTTTCG Chr18:67934705..67934724 60.11 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000386284 (Chr18:67934530..67934774 +)
Downstram Exon
ENSMUSE00000707351 (Chr18:67934657..67934774 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CATCCACGATGTGTCTTTCG Chr18:67934705..67934724 60.11 50 GTCGAAAGACACATCGTGGA Chr18:67934729..67934748 59.68 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC

*** Putative Vector Insertion (Chr 18: 67934529 - 67934775) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000386284 Chr18:67934530..67934774 GTCGAAAGACACATCGTGGA Chr18:67934729..67934748 59.68 50
downstream ENSMUSE00000707351 Chr18:67934657..67934774 GTCGAAAGACACATCGTGGA Chr18:67934729..67934748 59.68 50
downstream ENSMUSE00000143171 Chr18:67938859..67938909 GCTCTCGCTCTTATCCCACA Chr18:67938882..67938901 60.5 55
downstream ENSMUSE00000143165 Chr18:67943569..67943715 CACACGCCATACAGATCCAC Chr18:67943598..67943617 59.99 55
downstream ENSMUSE00000143164 Chr18:67944541..67944752 GCAGCACAGCTTACACGAGA Chr18:67944729..67944748 60.36 55
downstream ENSMUSE00000143175 Chr18:67946810..67946908 TTGGCCATTGAATTTGGACT Chr18:67946878..67946897 60.31 40
downstream ENSMUSE00000143173 Chr18:67948346..67948486 GGTTGCTACTGCCAGGATGT Chr18:67948454..67948473 60.14 55
downstream ENSMUSE00000143167 Chr18:67948994..67949151 GTTCCAACTCACCCTCCAGA Chr18:67949096..67949115 60.09 55
downstream ENSMUSE00000357593 Chr18:67951518..67951669 TTACTGGGCTCCCGTTACCT Chr18:67951580..67951599 60.87 55
downstream ENSMUSE00000707352 Chr18:67951518..67952247 TGGCTCACATGAATCCGTAA Chr18:67951843..67951862 60.07 45
downstream ENSMUSE00000414890 Chr18:67952804..67953250 AAGGCCTTTTGGACTGTGTG Chr18:67952973..67952992 60.15 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACGTAATCGCCTTGCAGCAC Chr18:67934577..67934597 63.56 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000079614