Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11427
Trapped Gene
Dppa2 (ENSMUSG00000072419)
Vector Insertion
Chr 16: 48310653 - 48311687
Public Clones (sanger) (sanger) (sanger) F062D02 (ggtc) 3SD004B02 (ggtc) 5SD154G10 (ggtc)
M124A12 (ggtc) (ggtc) 5SE320H07 (ggtc) PST21100-NL (escells) IST10800D8 (tigm)
IST10992B10 (tigm)
Private Clones OST318141 (lexicon) OST314114 (lexicon) OST302888 (lexicon) OST297511 (lexicon)
OST286101 (lexicon) OST248140 (lexicon) OST215830 (lexicon) OST213973 (lexicon)
OST213543 (lexicon) OST208897 (lexicon) OST204169 (lexicon) OST192368 (lexicon)
OST95873 (lexicon)
Severity of mutation (?) Insertion after 4% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000699690 (Chr16:48310590..48310652 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCATACTTCGGCCTGGAGAC Chr16:48310623..48310642 60.22 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000699690 (Chr16:48310590..48310652 +)
Downstram Exon
ENSMUSE00000629029 (Chr16:48311688..48311823 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCATACTTCGGCCTGGAGAC Chr16:48310623..48310642 60.22 55 AAGGGGACCAGCGTTAAAAT Chr16:48311746..48311765 59.83 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000699690 Chr16:48310590..48310652 TCATACTTCGGCCTGGAGAC Chr16:48310623..48310642 60.22 55

*** Putative Vector Insertion (Chr 16: 48310653 - 48311687) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000629029 Chr16:48311688..48311823 AAGGGGACCAGCGTTAAAAT Chr16:48311746..48311765 59.83 45
downstream ENSMUSE00000699688 Chr16:48313996..48314147 GGTTGGGTGTTTGATTCCAG Chr16:48314039..48314058 60.21 50
downstream ENSMUSE00000699687 Chr16:48314242..48314295 GGAGTGTCTCCGAAGTCTCAA Chr16:48314279..48314299 59.44 52.38
downstream ENSMUSE00000699686 Chr16:48315775..48316030 GCTGCAAATGTGGACTCCTT Chr16:48315938..48315957 60.26 50
downstream ENSMUSE00000699684 Chr16:48317401..48317596 TACAGGCCGGTAACAGGAAG Chr16:48317544..48317563 60.12 55
downstream ENSMUSE00000699682 Chr16:48318746..48319625 GTTAAAATGCAACGGGCTGT Chr16:48319027..48319046 60 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATGTCATACTTCGGCCTGGA Chr16:48310621..48310641 60.48 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGAGTTCTTTCGTGACTGG Chr16:48310693..48310713 59.7 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000072419