Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11446
Trapped Gene
Tfdp2 (ENSMUSG00000032411)
Vector Insertion
Chr 9: 96102608 - 96133100
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) E119B03 (ggtc) E001G03 (ggtc) E069C12 (ggtc)
D161H08 (ggtc) 3SE223D06 (ggtc) (ggtc) E138A02 (ggtc) E048H08 (ggtc)
D064C11 (ggtc) M120H01 (ggtc) E100E10 (ggtc) D184G03 (ggtc) (ggtc)
E061H07 (ggtc) D065A04 (ggtc) (ggtc) E119B03 (ggtc) E048H08 (ggtc)
E077B04 (ggtc) D161H08 (ggtc) 5SE223D06 (ggtc) (ggtc) E138A02 (ggtc)
E061H07 (ggtc) D065A04 (ggtc) (ggtc) CMHD-GT_471B4-3 (cmhd) CMHD-GT_303H5-3 (cmhd)
CMHD-GT_496F3-3 (cmhd) CMHD-GT_516D11-5S (cmhd) CMHD-GT_475H1-3 (cmhd) CMHD-GT_346H7-3 (cmhd)
CMHD-GT_503C9-3 (cmhd) FHCRC-GT-S3-5F1 (fhcrc) IST10582E11 (tigm) IST14402G12 (tigm)
IST14976G3 (tigm) IST12369F10 (tigm) IST12368B4 (tigm) IST12275B2 (tigm)
IST11623B4 (tigm) IST13845G3 (tigm) IST14659F3 (tigm) IST12756F5 (tigm)
IST10103E5 (tigm) IST12668G5 (tigm) IST14583F2 (tigm) IST14641G8 (tigm)
IST12562B8 (tigm) IST13100D2 (tigm) IST10965D2 (tigm) IST10582E11 (tigm)
IST10194C9 (tigm) IST11594E1 (tigm) IST11103F9 (tigm) IST14887G9 (tigm)
IST11609C7 (tigm) IST14590F11 (tigm) IST11033G7 (tigm) IST10116B4 (tigm)
IST10090B9 (tigm) IST14724E6 (tigm) IST12562C2 (tigm) IST12031B4 (tigm)
IST10031C9 (tigm) IST12668G5 (tigm) IST10568G7 (tigm) IST14989E2 (tigm)
IST12293D7 (tigm) IST14516D11 (tigm) IST12601A11 (tigm) IST10031C9BBR1 (tigm)
IST14839E11 (tigm) IST14830C4 (tigm) IST12369F10 (tigm) IST14254G6 (tigm)
IST12689A9 (tigm) IST14674B2 (tigm) IST14295G4 (tigm) IST10568G7 (tigm)
IST14384A8 (tigm) IST12945D5 (tigm) IST15003G3 (tigm) IST10103E5 (tigm)
IST14790B8 (tigm) IST14225G9 (tigm) IST15059A8 (tigm) IST14047C7 (tigm)
IST11763D7 (tigm) IST12130F6 (tigm) IST14889C10 (tigm) IST13439E6 (tigm)
IST13659B2 (tigm)
Private Clones OST466237 (lexicon) OST465961 (lexicon) OST461751 (lexicon) OST434701 (lexicon)
OST432828 (lexicon) OST422377 (lexicon) OST379910 (lexicon) OST379041 (lexicon)
OST377432 (lexicon) OST357395 (lexicon) OST347995 (lexicon) OST345151 (lexicon)
OST323578 (lexicon) OST308641 (lexicon) OST299544 (lexicon) OST297279 (lexicon)
OST278051 (lexicon) OST276428 (lexicon) OST268348 (lexicon) OST255961 (lexicon)
OST208106 (lexicon) OST185485 (lexicon) OST173082 (lexicon) OST173022 (lexicon)
OST171177 (lexicon) OST168138 (lexicon) OST151175 (lexicon) OST146527 (lexicon)
OST142848 (lexicon) OST127841 (lexicon) OST123500 (lexicon) OST121351 (lexicon)
OST121318 (lexicon) OST119193 (lexicon) OST109281 (lexicon) OST76839 (lexicon)
OST67714 (lexicon) OST67408 (lexicon) OST67122 (lexicon) OST58675 (lexicon)
OST41853 (lexicon) OST39371 (lexicon) OST37967 (lexicon) OST37821 (lexicon)
OST36575 (lexicon) OST35747 (lexicon) OST34037 (lexicon) OST32213 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000634875 (Chr9:96102550..96102607 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTGAAGAGAGAGCCCTGAT Chr9:96102581..96102600 58.72 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000634875 (Chr9:96102550..96102607 +)
Downstram Exon
ENSMUSE00000693791 (Chr9:96133101..96133167 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTGAAGAGAGAGCCCTGAT Chr9:96102581..96102600 58.72 55 CTCAGCTCTGCATTTGTGGA Chr9:96133135..96133154 60.14 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000634876 Chr9:96096767..96096979 GCCTTGACCCTTCCTGCACT Chr9:96096799..96096818 63.94 60
upstream ENSMUSE00000634875 Chr9:96102550..96102607 GCTGAAGAGAGAGCCCTGAT Chr9:96102581..96102600 58.72 55

*** Putative Vector Insertion (Chr 9: 96102608 - 96133100) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000693791 Chr9:96133101..96133167 CTCAGCTCTGCATTTGTGGA Chr9:96133135..96133154 60.14 50
downstream ENSMUSE00000693790 Chr9:96147469..96147507 GACCCAGCAATTCCACTTGTA Chr9:96147504..96147524 59.99 47.62
downstream ENSMUSE00000219556 Chr9:96174258..96174361 GGCCCTAAGGTTTTCGGTAA Chr9:96174336..96174355 60.31 50
downstream ENSMUSE00000489999 Chr9:96188020..96188141 CAATTCTCTGCGGTGTGCTT Chr9:96188047..96188066 61.38 50
downstream ENSMUSE00000233223 Chr9:96190999..96191046 No primer for this exon
downstream ENSMUSE00000530945 Chr9:96195384..96195546 TTCCGCTGAACTTTCTCACA Chr9:96195467..96195486 59.57 45
downstream ENSMUSE00000693779 Chr9:96198043..96198189 CCTGAGCAGAATTGGTAGGC Chr9:96198175..96198194 59.84 55
downstream ENSMUSE00000462451 Chr9:96198046..96198189 CCTGAGCAGAATTGGTAGGC Chr9:96198175..96198194 59.84 55
downstream ENSMUSE00000530944 Chr9:96200791..96200859 TCTATCCGCCTCTGCTTCTC Chr9:96200816..96200835 59.68 55
downstream ENSMUSE00000530943 Chr9:96207219..96207370 TAAATGGCAGCTGAATGGTG Chr9:96207318..96207337 59.69 45
downstream ENSMUSE00000530942 Chr9:96210941..96211107 TGTCGTCGTGGATCTCAAAG Chr9:96210993..96211012 59.83 50
downstream ENSMUSE00000530941 Chr9:96217896..96218001 CCAAGAAGGTCCTGTGGAGA Chr9:96217921..96217940 60.23 55
downstream ENSMUSE00000459397 Chr9:96218207..96219400 CGTAAAAGCTTGCTCCGTTC Chr9:96218934..96218953 60.02 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTGAGGCTGCTGTCCTTGTA Chr9:96126591..96126611 59.59 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGAGGCTGCTGTCCTTGTA Chr9:96126591..96126611 59.59 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032411