Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11455
Trapped Gene
AC163344.2 (ENSMUSG00000052724)
Vector Insertion
Chr 9: 114690600 - 114690806
Public Clones M120A07 (ggtc) IST12048G6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 78% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000583058 (Chr9:114690416..114690599 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCAGGGGATAGCAGGAGACT Chr9:114690498..114690517 60.76 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000583058 (Chr9:114690416..114690599 +)
Downstram Exon
ENSMUSE00000439089 (Chr9:114690807..114691375 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCAGGGGATAGCAGGAGACT Chr9:114690498..114690517 60.76 60 TTCCCCCTACTCGTGTCAGT Chr9:114691252..114691271 59.57 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000583059 Chr9:114689218..114689429 CTCACTCCCAGGACTTGGTC Chr9:114689290..114689309 59.68 60
upstream ENSMUSE00000583058 Chr9:114690416..114690599 GCAGGGGATAGCAGGAGACT Chr9:114690498..114690517 60.76 60

*** Putative Vector Insertion (Chr 9: 114690600 - 114690806) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000439089 Chr9:114690807..114691375 TTCCCCCTACTCGTGTCAGT Chr9:114691252..114691271 59.57 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGGCAGCTGGAGAAGTGAG Chr9:114690628..114690648 60.28 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGGCAGCTGGAGAAGTGAG Chr9:114690628..114690648 60.28 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000052724