Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11462
Trapped Gene
Top2a (ENSMUSG00000020914)
Vector Insertion
Chr 11: 98860662 - 98862081
Public Clones M029C05 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 77% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000648099 (Chr11:98862082..98862165 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000648099 (Chr11:98862082..98862165 -)
Downstram Exon
ENSMUSE00000648098 (Chr11:98860476..98860661 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000413238 Chr11:98885360..98885429 No primer for this exon
upstream ENSMUSE00000648125 Chr11:98884154..98884306 No primer for this exon
upstream ENSMUSE00000648124 Chr11:98883654..98883744 No primer for this exon
upstream ENSMUSE00000648123 Chr11:98883025..98883088 No primer for this exon
upstream ENSMUSE00000648122 Chr11:98880110..98880255 No primer for this exon
upstream ENSMUSE00000648121 Chr11:98877744..98877841 No primer for this exon
upstream ENSMUSE00000648120 Chr11:98877342..98877554 No primer for this exon
upstream ENSMUSE00000648119 Chr11:98876200..98876373 No primer for this exon
upstream ENSMUSE00000648118 Chr11:98876002..98876103 No primer for this exon
upstream ENSMUSE00000648117 Chr11:98875729..98875866 No primer for this exon
upstream ENSMUSE00000648115 Chr11:98873335..98873473 No primer for this exon
upstream ENSMUSE00000648114 Chr11:98872220..98872377 No primer for this exon
upstream ENSMUSE00000648113 Chr11:98871788..98871913 No primer for this exon
upstream ENSMUSE00000648112 Chr11:98871342..98871452 No primer for this exon
upstream ENSMUSE00000648111 Chr11:98871107..98871212 No primer for this exon
upstream ENSMUSE00000648110 Chr11:98870904..98871013 No primer for this exon
upstream ENSMUSE00000648109 Chr11:98870544..98870636 No primer for this exon
upstream ENSMUSE00000648108 Chr11:98868495..98868609 No primer for this exon
upstream ENSMUSE00000648107 Chr11:98868274..98868395 No primer for this exon
upstream ENSMUSE00000648106 Chr11:98867317..98867465 No primer for this exon
upstream ENSMUSE00000648105 Chr11:98865426..98865657 No primer for this exon
upstream ENSMUSE00000648104 Chr11:98865140..98865274 No primer for this exon
upstream ENSMUSE00000648103 Chr11:98864821..98865021 No primer for this exon
upstream ENSMUSE00000648102 Chr11:98864188..98864383 No primer for this exon
upstream ENSMUSE00000648101 Chr11:98862664..98862755 No primer for this exon
upstream ENSMUSE00000648100 Chr11:98862288..98862446 No primer for this exon
upstream ENSMUSE00000648099 Chr11:98862082..98862165 No primer for this exon

*** Putative Vector Insertion (Chr 11: 98860662 - 98862081) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000648098 Chr11:98860476..98860661 No primer for this exon
downstream ENSMUSE00000112505 Chr11:98859143..98859233 No primer for this exon
downstream ENSMUSE00000112511 Chr11:98858043..98858189 No primer for this exon
downstream ENSMUSE00000112512 Chr11:98857164..98857287 No primer for this exon
downstream ENSMUSE00000112513 Chr11:98856995..98857038 No primer for this exon
downstream ENSMUSE00000112508 Chr11:98856558..98856692 No primer for this exon
downstream ENSMUSE00000112506 Chr11:98855521..98855720 No primer for this exon
downstream ENSMUSE00000507170 Chr11:98855078..98855249 No primer for this exon
downstream ENSMUSE00000648126 Chr11:98854717..98854727 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGAAGGAAGATCTGGCTGTT Chr11:98862098..98862118 58.32 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAAGGAAGATCTGGCTGTT Chr11:98862098..98862118 58.32 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020914