Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11476
Trapped Gene
1110039B18Rik (ENSMUSG00000038828)
Vector Insertion
Chr 5: 31177024 - 31177223
Public Clones P070G07 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 66% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000273435 (Chr5:31176910..31177023 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTTCTGAAGAAGGGCAGTG Chr5:31176963..31176982 60.13 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000273435 (Chr5:31176910..31177023 +)
Downstram Exon
ENSMUSE00000273424 (Chr5:31177224..31177341 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTTCTGAAGAAGGGCAGTG Chr5:31176963..31176982 60.13 55 AGAGCTGTTTGACCGCAAGT Chr5:31177337..31177356 60.06 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000358018 Chr5:31172004..31172191 GAGGTGGTGGAGCTGAAGTC Chr5:31172021..31172040 59.84 60
upstream ENSMUSE00000700359 Chr5:31172032..31172191 No primer for this exon
upstream ENSMUSE00000389399 Chr5:31172962..31173161 TATGAGCGTGGCTTTGAGAA Chr5:31172988..31173007 59.57 45
upstream ENSMUSE00000346110 Chr5:31173793..31173943 AGAGCCAGAGCGTGTTCACT Chr5:31173827..31173846 60.21 55
upstream ENSMUSE00000369886 Chr5:31174094..31174228 CGAGAGCTACGTGGGATCAT Chr5:31174117..31174136 60.24 55
upstream ENSMUSE00000403256 Chr5:31174445..31174527 AAGCCGTTCTGCAAGACAAG Chr5:31174478..31174497 60.57 50
upstream ENSMUSE00000352392 Chr5:31174874..31174979 GGGTTTCACCAACCTCACTG Chr5:31174948..31174967 60.4 55
upstream ENSMUSE00000273484 Chr5:31175060..31175141 CTCTGTCTCCCTTTGCCATC Chr5:31175099..31175118 59.8 55
upstream ENSMUSE00000273472 Chr5:31175416..31175517 CAAGGACTTCTTCCCCCTTC Chr5:31175458..31175477 60.04 55
upstream ENSMUSE00000273462 Chr5:31175868..31176009 GCACACCTACTTCCCGTCAT Chr5:31175943..31175962 60 55
upstream ENSMUSE00000273452 Chr5:31176329..31176420 ACAGCTGTACCCCAAGCATC Chr5:31176388..31176407 60.14 55
upstream ENSMUSE00000273443 Chr5:31176686..31176734 CTCAAGTCCTGGGAGCACAT Chr5:31176705..31176724 60.26 55
upstream ENSMUSE00000273435 Chr5:31176910..31177023 GCTTCTGAAGAAGGGCAGTG Chr5:31176963..31176982 60.13 55

*** Putative Vector Insertion (Chr 5: 31177024 - 31177223) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000273424 Chr5:31177224..31177341 AGAGCTGTTTGACCGCAAGT Chr5:31177337..31177356 60.06 50
downstream ENSMUSE00000273413 Chr5:31178163..31178259 AGGAGGAGAGTCTCGCACAC Chr5:31178243..31178262 59.58 60
downstream ENSMUSE00000273406 Chr5:31178420..31178588 ACTGAAGCAGGCAAGGTAGG Chr5:31178564..31178583 59.5 55
downstream ENSMUSE00000273401 Chr5:31178736..31178881 AGCACGCTATGGCAGAAGAG Chr5:31178815..31178834 60.7 55
downstream ENSMUSE00000404652 Chr5:31179037..31179835 AGGCTCCCAGCCTAGAAGAG Chr5:31179397..31179416 60.11 60
downstream ENSMUSE00000700343 Chr5:31179037..31179417 GAGTGCCCAGTCCAAGAAAG Chr5:31179145..31179164 59.84 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CACTAATCGCCTTGCAGCAC Chr5:31177072..31177092 61.9 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTAACACCGTGACTGGGAAAA Chr5:31177068..31177089 60.02 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038828