Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11477
Trapped Gene
Gcnt2 (ENSMUSG00000021360)
Vector Insertion
Chr 13: 40983659 - 40984563
Public Clones M117C08 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000683058 (Chr13:40982736..40983658 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000683058 (Chr13:40982736..40983658 +)
Downstram Exon
ENSMUSE00000683057 (Chr13:40984564..40984579 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000683059 Chr13:40955501..40956642 No primer for this exon
upstream ENSMUSE00000500581 Chr13:40982535..40983654 No primer for this exon
upstream ENSMUSE00000683058 Chr13:40982736..40983658 No primer for this exon

*** Putative Vector Insertion (Chr 13: 40983659 - 40984563) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000683057 Chr13:40984564..40984579 No primer for this exon
downstream ENSMUSE00000288319 Chr13:41013003..41014170 No primer for this exon
downstream ENSMUSE00000446426 Chr13:41048945..41049040 No primer for this exon
downstream ENSMUSE00000446420 Chr13:41053521..41056260 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGTCCCGATGAGCATTTCTG Chr13:40983613..40983633 60.22 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGTCCCGATGAGCATTTCTG Chr13:40983613..40983633 60.22 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021360