Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11512
Trapped Gene
0610031J06Rik (ENSMUSG00000001418)
Vector Insertion
Chr 3: 88129124 - 88129598
Public Clones D150A02 (ggtc) P071G03 (ggtc) P084H04 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 10% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000292775 (Chr3:88128982..88129123 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000292775 (Chr3:88128982..88129123 +)
Downstram Exon
ENSMUSE00000476991 (Chr3:88129599..88129853 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000292775 Chr3:88128982..88129123 No primer for this exon

*** Putative Vector Insertion (Chr 3: 88129124 - 88129598) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000476991 Chr3:88129599..88129853 No primer for this exon
downstream ENSMUSE00000292764 Chr3:88130037..88130234 No primer for this exon
downstream ENSMUSE00000175669 Chr3:88130333..88130551 No primer for this exon
downstream ENSMUSE00000479558 Chr3:88131779..88132035 No primer for this exon
downstream ENSMUSE00000404501 Chr3:88132125..88132594 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACCTTTTAATCGCCTTGCAG Chr3:88129169..88129189 59.36 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTTTCGTGACTGGGAAAAC Chr3:88129170..88129190 59.57 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000001418