Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11554
Trapped Gene
Zfp91 (ENSMUSG00000024695)
Vector Insertion
Chr 19: 12853590 - 12864749
Public Clones M094A02 (ggtc) A031B04 (ggtc) (egtc)
Private Clones OST308460 (lexicon) OST270764 (lexicon) OST64880 (lexicon) OST63839 (lexicon)
OST37817 (lexicon)
Severity of mutation (?) Insertion after 22% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000491713 (Chr19:12864750..12864778 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000491713 (Chr19:12864750..12864778 -)
Downstram Exon
ENSMUSE00000238729 (Chr19:12853383..12853589 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TCGAAGGCGAGAGATAGAGG Chr19:12853452..12853471 59.67 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000716103 Chr19:12869474..12870606 TCCTGATTGGTTGGAGGAAG Chr19:12870145..12870164 60.04 50
upstream ENSMUSE00000491713 Chr19:12864750..12864778 No primer for this exon

*** Putative Vector Insertion (Chr 19: 12853590 - 12864749) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000238729 Chr19:12853383..12853589 TCGAAGGCGAGAGATAGAGG Chr19:12853452..12853471 59.67 55
downstream ENSMUSE00000620936 Chr19:12853114..12853150 CACCGGGAGACTGATGTTCT Chr19:12853099..12853118 60.11 55
downstream ENSMUSE00000620935 Chr19:12852432..12852536 CTTTCAAGGTGGGGCTTGTA Chr19:12852410..12852429 60.1 50
downstream ENSMUSE00000620934 Chr19:12851350..12851484 TGATTTTCTCCGTGGCTTTG Chr19:12851435..12851454 61.14 45
downstream ENSMUSE00000620933 Chr19:12850902..12850952 TCTTTTCGCCTTCTCCCTCT Chr19:12850910..12850929 60.46 50
downstream ENSMUSE00000620932 Chr19:12850485..12850563 CTTCCATCTCACAACGGACA Chr19:12850501..12850520 59.68 50
downstream ENSMUSE00000620931 Chr19:12849310..12849424 ATGCCGCAGAAGTTGTTTCT Chr19:12849304..12849323 59.88 45
downstream ENSMUSE00000620930 Chr19:12845493..12845592 CGGTGTACTGCCAGATTGTG Chr19:12845501..12845520 60.17 55
downstream ENSMUSE00000439880 Chr19:12844667..12845039 TTCTGCAATCAGCACCTCAG Chr19:12844840..12844859 60.14 50
downstream ENSMUSE00000642818 Chr19:12840496..12845039 GGTCCCCATGTATCCTTCCT Chr19:12843938..12843957 60.01 55
downstream ENSMUSE00000693676 Chr19:12839771..12839896 GCCAGATAGAGCGGCTACAG Chr19:12839796..12839815 60.14 60
downstream ENSMUSE00000693675 Chr19:12838018..12838870 ACGTGGGTCAACCCTACTTG Chr19:12838230..12838249 59.88 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGAGAGGCAGAGGACCAAAT Chr19:12861741..12861761 59.8 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGAGAGGCAGAGGACCAAAT Chr19:12861741..12861761 59.8 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024695