Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11562
Trapped Gene
Rpl18a (ENSMUSG00000045128)
Vector Insertion
Chr 8: 73420212 - 73421257
Public Clones (sanger) (sanger) (ggtc) P068B06 (ggtc) (ggtc) (ggtc)
IST14600C10 (tigm) IST11035G9 (tigm)
Private Clones OST10013 (lexicon)
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000511326 (Chr8:73421258..73421313 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTTTGTGACTGGCGGTGAAC Chr8:73421290..73421309 62.07 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000511326 (Chr8:73421258..73421313 -)
Downstram Exon
ENSMUSE00000510453 (Chr8:73420032..73420211 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTTTGTGACTGGCGGTGAAC Chr8:73421290..73421309 62.07 50 GTACACAATTTCCCCGGATG Chr8:73420019..73420038 60.05 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000511326 Chr8:73421258..73421313 TTTTGTGACTGGCGGTGAAC Chr8:73421290..73421309 62.07 50

*** Putative Vector Insertion (Chr 8: 73420212 - 73421257) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000510453 Chr8:73420032..73420211 GTACACAATTTCCCCGGATG Chr8:73420019..73420038 60.05 50
downstream ENSMUSE00000517686 Chr8:73419815..73419944 GAGTCATAGCGCAGCCAGAT Chr8:73419864..73419883 60.53 55
downstream ENSMUSE00000516802 Chr8:73419499..73419608 GCTGCAATCTCTTCCACCTT Chr8:73419514..73419533 59.43 50
downstream ENSMUSE00000392825 Chr8:73419278..73419406 GGCAGTGGGAATTTGATCTT Chr8:73419359..73419378 58.98 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAATCGCCTTGCAGCACAT Chr8:73421187..73421207 61.32 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGACTGGCGGTGAACGAGT Chr8:73421284..73421304 63.67 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TCAGAGACCATGGTGAGAGC Chr8:73421330..73421350 58.92 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TCAGAGACCATGGTGAGAGC Chr8:73421330..73421350 58.92 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000045128