Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11569
Trapped Gene
AC136516.3 (ENSMUSG00000070035)
Vector Insertion
Chr 7: 79818825 - 79818926
Public Clones P067A05 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 83% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000530654 (Chr7:79817704..79818824 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGAAGCGCCGCTATTTACA Chr7:79818364..79818383 60.01 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000530654 (Chr7:79817704..79818824 +)
Downstram Exon
ENSMUSE00000132438 (Chr7:79818927..79819164 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGAAGCGCCGCTATTTACA Chr7:79818364..79818383 60.01 45 ATTCGCAGTAGCCAATCCAC Chr7:79819137..79819156 60.1 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000530654 Chr7:79817704..79818824 AAGAAGCGCCGCTATTTACA Chr7:79818364..79818383 60.01 45

*** Putative Vector Insertion (Chr 7: 79818825 - 79818926) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000132438 Chr7:79818927..79819164 ATTCGCAGTAGCCAATCCAC Chr7:79819137..79819156 60.1 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCAGTTGCCTCCTCAGATGT Chr7:79818796..79818816 60.26 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCAGTTGCCTCCTCAGATGT Chr7:79818796..79818816 60.26 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000070035