Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11573
Trapped Gene
Evi5 (ENSMUSG00000011831)
Vector Insertion
Chr 5: 108304007 - 108304127
Public Clones P066E03 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000721175 (Chr5:108304008..108304126 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000721175 (Chr5:108304008..108304126 -)
Downstram Exon
ENSMUSE00000716444 (Chr5:108304008..108304126 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000716444 Chr5:108304008..108304126 No primer for this exon
upstream ENSMUSE00000719086 Chr5:108304008..108304126 No primer for this exon
upstream ENSMUSE00000721175 Chr5:108304008..108304126 No primer for this exon

*** Putative Vector Insertion (Chr 5: 108304007 - 108304127) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000541284 Chr5:108271090..108271319 No primer for this exon
downstream ENSMUSE00000651435 Chr5:108271090..108271319 No primer for this exon
downstream ENSMUSE00000254281 Chr5:108250724..108250913 No primer for this exon
downstream ENSMUSE00000459398 Chr5:108249451..108249675 No primer for this exon
downstream ENSMUSE00000459394 Chr5:108248674..108248697 No primer for this exon
downstream ENSMUSE00000459390 Chr5:108248631..108248669 No primer for this exon
downstream ENSMUSE00000651434 Chr5:108248623..108248628 No primer for this exon
downstream ENSMUSE00000651440 Chr5:108248623..108248697 No primer for this exon
downstream ENSMUSE00000596113 Chr5:108247908..108248033 No primer for this exon
downstream ENSMUSE00000459379 Chr5:108245793..108245936 No primer for this exon
downstream ENSMUSE00000459374 Chr5:108244821..108244910 No primer for this exon
downstream ENSMUSE00000459367 Chr5:108244630..108244727 No primer for this exon
downstream ENSMUSE00000459363 Chr5:108242565..108242625 No primer for this exon
downstream ENSMUSE00000459359 Chr5:108241377..108241430 No primer for this exon
downstream ENSMUSE00000651438 Chr5:108239309..108239341 No primer for this exon
downstream ENSMUSE00000651437 Chr5:108238609..108238755 No primer for this exon
downstream ENSMUSE00000187588 Chr5:108228145..108228279 No primer for this exon
downstream ENSMUSE00000187578 Chr5:108226832..108226972 No primer for this exon
downstream ENSMUSE00000710399 Chr5:108224718..108224876 No primer for this exon
downstream ENSMUSE00000711532 Chr5:108224718..108224876 No primer for this exon
downstream ENSMUSE00000303496 Chr5:108219381..108219527 No primer for this exon
downstream ENSMUSE00000651432 Chr5:108219381..108219527 No primer for this exon
downstream ENSMUSE00000303490 Chr5:108217218..108217313 No primer for this exon
downstream ENSMUSE00000651431 Chr5:108217218..108217313 No primer for this exon
downstream ENSMUSE00000303483 Chr5:108193695..108193790 No primer for this exon
downstream ENSMUSE00000651430 Chr5:108193695..108193790 No primer for this exon
downstream ENSMUSE00000466933 Chr5:108173814..108177476 No primer for this exon
downstream ENSMUSE00000651429 Chr5:108173814..108177476 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTCTAATCGCCTTGCAGCAC Chr5:108304059..108304079 61.07 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000011831