CBM UniTrap Project

UniTrap UNI11583

Trapped Gene	Zcchc10 (ENSMUSG00000018239)
Vector Insertion	Chr 11: 53138244 - 53140770
Public Clones	D143D05 (ggtc) D099H08 (ggtc) D130F01 (ggtc) M094C02 (ggtc) D130C01 (ggtc) (ggtc) CMHD-GT_481H8-3 (cmhd) CMHD-GT_525A1-3 (cmhd) CMHD-GT_481F11-3 (cmhd) CMHD-GT_481B2-3 (cmhd) CMHD-GT_421A12-3 (cmhd) CMHD-GT_481H10-3 (cmhd) (cmhd) CMHD-GT_481C1-3 (cmhd) CMHD-GT_481D9-3 (cmhd) CMHD-GT_469B5-3 (cmhd) CMHD-GT_481E9-3 (cmhd) CMHD-GT_472C12-3 (cmhd) CMHD-GT_481A11-3 (cmhd) IST14884A11 (tigm) IST14732C7 (tigm) IST11273G3 (tigm) IST14106C1 (tigm) IST10559E4BBF1 (tigm) IST10559E4 (tigm) IST14732C7 (tigm) IST14426E3 (tigm) IST14426E3 (tigm)
Private Clones	OST471224 (lexicon) OST441836 (lexicon) OST423775 (lexicon) OST415951 (lexicon) OST376933 (lexicon) OST374324 (lexicon) OST352035 (lexicon) OST346025 (lexicon) OST310525 (lexicon) OST302640 (lexicon) OST296711 (lexicon) OST293430 (lexicon) OST288063 (lexicon) OST281960 (lexicon) OST272940 (lexicon) OST270979 (lexicon) OST264112 (lexicon) OST251771 (lexicon) OST242806 (lexicon) OST224088 (lexicon) OST214774 (lexicon) OST184256 (lexicon) OST177630 (lexicon) OST172172 (lexicon) OST171398 (lexicon) OST168459 (lexicon) OST158328 (lexicon) OST144224 (lexicon) OST144192 (lexicon) OST142257 (lexicon) OST140726 (lexicon) OST133660 (lexicon) OST129915 (lexicon) OST108590 (lexicon) OST100945 (lexicon) OST100476 (lexicon) OST90893 (lexicon) OST89869 (lexicon) OST87435 (lexicon) OST82429 (lexicon) OST79074 (lexicon) OST78874 (lexicon) OST77781 (lexicon) OST77710 (lexicon) OST77266 (lexicon) OST73936 (lexicon) OST62962 (lexicon) OST54217 (lexicon) OST48132 (lexicon) OST32760 (lexicon) OST30091 (lexicon)
Severity of mutation (?)	Insertion after 8% of polypeptide chain

Suggested RT-PCR (?)

Control PCR for the trapped allele
Upstream Exon ENSMUSE00000103821 (Chr11:53138184..53138243 +)				Vector Sequence
Forward Primer	Location	Tm	%GC	LacZrt Reverse Primer	Location
No primer for this exon				TGGCGAAAGGGGGATGTG	Gene trap vector


Control PCR for the wild-type allele
Upstream Exon ENSMUSE00000103821 (Chr11:53138184..53138243 +)				Downstram Exon ENSMUSE00000103815 (Chr11:53140771..53140929 +)
Forward Primer	Location	Tm	%GC	Reverse Primer	Location	Tm	%GC
No primer for this exon				No primer for this exon

Other possible Exon-Primers for RT-PCR (?)

	Exon ID	Exon location	Forward Primer	Primer location	Tm	%GC
upstream	ENSMUSE00000103821	Chr11:53138184..53138243	No primer for this exon
* Putative Vector Insertion (Chr 11: 53138244 - 53140770) *
	Exon ID	Exon location	Reverse Primer	Primer location	Tm	%GC
downstream	ENSMUSE00000103815	Chr11:53140771..53140929	No primer for this exon
downstream	ENSMUSE00000103823	Chr11:53144189..53144233	No primer for this exon
downstream	ENSMUSE00000374181	Chr11:53145804..53146790	No primer for this exon

Suggested Genomic-PCR (?)

	Forward	Forward location	Tm	%GC	Reverse name	Reverse	Reverse Location
PCR 1	GGCTCATAGCTCGAAGGAAA	Chr11:53138223..53138243	59.55	50	L232	GATGTGCTGCAAGGCGATTA	Gene trap vector
PCR 2	GGCTCATAGCTCGAAGGAAA	Chr11:53138223..53138243	59.55	50	LacZ	CCAGGGTTTTCCCAGTCACG	Gene trap vector

Come back to gene ENSMUSG00000018239