Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11590
Trapped Gene
2610101N10Rik (ENSMUSG00000032407)
Vector Insertion
Chr 9: 95391896 - 95392742
Public Clones P062D02 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 17% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000513442 (Chr9:95392743..95392810 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000513442 (Chr9:95392743..95392810 -)
Downstram Exon
ENSMUSE00000219471 (Chr9:95391801..95391895 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GAGGAGGCTCAAACCGACTT Chr9:95391809..95391828 60.77 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000219473 Chr9:95412236..95412313 CTCAAGATGGCCGACAAAAC Chr9:95412267..95412286 60.64 50
upstream ENSMUSE00000219468 Chr9:95402959..95403003 No primer for this exon
upstream ENSMUSE00000219475 Chr9:95401107..95401238 CCTTTGCGATTCTCCTCATC Chr9:95401121..95401140 59.77 50
upstream ENSMUSE00000219477 Chr9:95396254..95396352 CAGCAAAGCGAACCCTAAGT Chr9:95396284..95396303 59.52 50
upstream ENSMUSE00000219474 Chr9:95394122..95394236 CGGGGTTGTTAATGCAGCTA Chr9:95394125..95394144 61.01 50
upstream ENSMUSE00000219470 Chr9:95393517..95393650 CCTCCAAATCAGTCATCCAA Chr9:95393560..95393579 58.49 45
upstream ENSMUSE00000513442 Chr9:95392743..95392810 No primer for this exon

*** Putative Vector Insertion (Chr 9: 95391896 - 95392742) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000219471 Chr9:95391801..95391895 GAGGAGGCTCAAACCGACTT Chr9:95391809..95391828 60.77 55
downstream ENSMUSE00000219469 Chr9:95391684..95391719 TCTTCTTGAAGGCACATCCA Chr9:95391678..95391697 59.37 45
downstream ENSMUSE00000219476 Chr9:95391510..95391592 GTGAGCCAGGTGCATAATCA Chr9:95391544..95391563 59.68 50
downstream ENSMUSE00000693972 Chr9:95390509..95390674 CTTGGCACAGCATTTCTTCA Chr9:95390628..95390647 59.99 45
downstream ENSMUSE00000517875 Chr9:95390119..95390330 GGTGGTAACATGGGAGCATT Chr9:95390125..95390144 59.68 50
downstream ENSMUSE00000518756 Chr9:95389165..95389208 TTTGACTATGGCTTGCGACA Chr9:95389163..95389182 60.4 45
downstream ENSMUSE00000521498 Chr9:95385980..95386084 ATTGGCCCTTCACGTACAAC Chr9:95386006..95386025 59.86 50
downstream ENSMUSE00000514792 Chr9:95384827..95384893 TAAACATGGGCTGGTGTCTG Chr9:95384836..95384855 59.57 50
downstream ENSMUSE00000492023 Chr9:95384589..95384752 CCTCTGACATCCCATGAAGG Chr9:95384625..95384644 60.47 55
downstream ENSMUSE00000492971 Chr9:95382511..95382673 CAGAAAACCATGGCATCTCC Chr9:95382574..95382593 60.46 50
downstream ENSMUSE00000493903 Chr9:95382072..95382151 GGCAACTTTGGCTGAAGAGT Chr9:95382073..95382092 59.48 50
downstream ENSMUSE00000502555 Chr9:95379686..95379773 No primer for this exon
downstream ENSMUSE00000496222 Chr9:95377819..95377941 No primer for this exon
downstream ENSMUSE00000497069 Chr9:95376526..95376682 TATAGGGACCCCATCCAGGT Chr9:95376538..95376557 60.4 55
downstream ENSMUSE00000498028 Chr9:95375621..95375716 CATTTTGATGGGGCAACTTT Chr9:95375634..95375653 59.8 40
downstream ENSMUSE00000491092 Chr9:95374840..95374906 No primer for this exon
downstream ENSMUSE00000501266 Chr9:95372462..95372621 CGAAGCTTAGCTCGCTTTTC Chr9:95372450..95372469 59.52 50
downstream ENSMUSE00000502185 Chr9:95366965..95367075 GAAGCTTTGGCCTGGTTTTT Chr9:95366985..95367004 60.59 45
downstream ENSMUSE00000374453 Chr9:95364782..95364900 No primer for this exon
downstream ENSMUSE00000415159 Chr9:95363122..95363298 GGCTGGGGGAGGTACTATGT Chr9:95363248..95363267 60.21 60
downstream ENSMUSE00000415153 Chr9:95360840..95361962 CTAGAGCGAGAGCGCCTAGA Chr9:95361890..95361909 60.15 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr9:95392671..95392691 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAATTTGGAACTTTTCAAAGAAGA Chr9:95392750..95392774 58.88 29.17 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032407