Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11593
Trapped Gene
Nup88 (ENSMUSG00000040667)
Vector Insertion
Chr 11: 70775171 - 70779208
Public Clones (sanger) W248A04 (ggtc) W247A05 (ggtc) P064C11 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 26% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000318258 (Chr11:70779209..70779334 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CATCCCGATTGCTGAGAGAT Chr11:70779312..70779331 60.18 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000318258 (Chr11:70779209..70779334 -)
Downstram Exon
ENSMUSE00000318221 (Chr11:70775084..70775170 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CATCCCGATTGCTGAGAGAT Chr11:70779312..70779331 60.18 50 GGGCTCACGGAGAGAATAAA Chr11:70775127..70775146 59.27 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000318240 Chr11:70783151..70783475 TAACCACGTCGTGTTCTTGC Chr11:70783378..70783397 59.76 50
upstream ENSMUSE00000677093 Chr11:70783151..70783456 TAACCACGTCGTGTTCTTGC Chr11:70783378..70783397 59.76 50
upstream ENSMUSE00000710354 Chr11:70783151..70783475 TAACCACGTCGTGTTCTTGC Chr11:70783378..70783397 59.76 50
upstream ENSMUSE00000318230 Chr11:70781350..70781519 TTGAGTCCAACCCAACATCA Chr11:70781452..70781471 59.94 45
upstream ENSMUSE00000318258 Chr11:70779209..70779334 CATCCCGATTGCTGAGAGAT Chr11:70779312..70779331 60.18 50

*** Putative Vector Insertion (Chr 11: 70775171 - 70779208) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000318221 Chr11:70775084..70775170 GGGCTCACGGAGAGAATAAA Chr11:70775127..70775146 59.27 50
downstream ENSMUSE00000318216 Chr11:70771768..70771941 GGATACGCCACCACATCTCT Chr11:70771806..70771825 59.96 55
downstream ENSMUSE00000318208 Chr11:70769638..70769824 ATTTGGAACACAGGGCAAAC Chr11:70769694..70769713 59.84 45
downstream ENSMUSE00000318200 Chr11:70768003..70768150 AGGGATCGTCCTCTCCAGAT Chr11:70768020..70768039 60.03 55
downstream ENSMUSE00000318195 Chr11:70764762..70764860 CCGATCCAAGAAATTTGTGC Chr11:70764740..70764759 60.45 45
downstream ENSMUSE00000318193 Chr11:70763648..70763738 TGTGCTCCACAAAGCATTTC Chr11:70763654..70763673 59.85 45
downstream ENSMUSE00000318191 Chr11:70761204..70761305 GAATCCTCGAATTGGAGCTG Chr11:70761259..70761278 59.77 50
downstream ENSMUSE00000318186 Chr11:70758705..70758863 CAGCACTACGCTGCAAGATT Chr11:70758702..70758721 59.25 50
downstream ENSMUSE00000318180 Chr11:70758347..70758487 CTCCGCTGAATCTCCTCCTT Chr11:70758325..70758344 60.86 55
downstream ENSMUSE00000677092 Chr11:70758347..70758472 CTCCGCTGAATCTCCTCCTT Chr11:70758325..70758344 60.86 55
downstream ENSMUSE00000318178 Chr11:70758175..70758240 TCGAGTTGTTTCCTCTTTTGG Chr11:70758180..70758200 59.34 42.86
downstream ENSMUSE00000318174 Chr11:70757984..70758082 ATTTCCCGGAGACTTTTCCT Chr11:70758025..70758044 59.03 45
downstream ENSMUSE00000677096 Chr11:70757984..70758064 CCATTTCCCGGAGACTTTTC Chr11:70758023..70758042 60.8 50
downstream ENSMUSE00000318169 Chr11:70757614..70757740 TTGCCTAGATGTCGCAGTTG Chr11:70757605..70757624 60.01 50
downstream ENSMUSE00000318163 Chr11:70757381..70757499 AATGCACTTTCGCTGGTAGG Chr11:70757379..70757398 60.27 50
downstream ENSMUSE00000677091 Chr11:70756604..70756824 CAGGTGGTGTCAGAAGGTGA Chr11:70756730..70756749 59.71 55
downstream ENSMUSE00000677097 Chr11:70756584..70756824 CAGGTGGTGTCAGAAGGTGA Chr11:70756730..70756749 59.71 55
downstream ENSMUSE00000358753 Chr11:70756574..70756824 CAGGTGGTGTCAGAAGGTGA Chr11:70756730..70756749 59.71 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr11:70776138..70776158 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GATGCTGGATCCCCACATAG Chr11:70779235..70779255 60.3 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AGGCTAACTAATCGCCTTGC Chr11:70776272..70776292 58.63 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CTAACCGTGACTGGGAAAACC Chr11:70776268..70776289 60.76 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040667